SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Sequence transposon flanking region Akira Sample Prep / Library Generation 8 03-18-2012 07:53 AM
Newbler vector trimming issue andylai 454 Pyrosequencing 7 01-10-2012 11:16 AM
Please Help: What is the differences between standard trimming and adaptive trimming byou678 Bioinformatics 8 08-22-2011 01:05 PM
Vector contamination? gconcepcion Illumina/Solexa 5 02-08-2011 06:14 AM
trimming barcoded sequences dawe Bioinformatics 7 03-26-2010 07:14 AM

Reply
 
Thread Tools
Old 09-14-2010, 03:53 PM   #1
sulicon
Member
 
Location: Los Angeles

Join Date: Aug 2010
Posts: 41
Default Vector trimming: are flanking sequences sufficient?

Hi All,

I have met a strange problem when using newbler to trim vector sequence. The vector structure is:
Forward Primer ----> CDNA sequence ---->Reverse Primer

I was told only the three parts (forward & reverse primer, CDNA) could be sequenced. At first, I just used the flanking sequences, i.e. the primer sequences, for vector trimming (newbler -vt flanking.fa ...). I found some vector sequences remained in the result. For example:

vector sequence in assembled contig:
AATGCCAACTTTGTACAAAAAAaGTTGGCACC

part of the primer sequence:
AATGCCAACTTTGTACAAAAAAGTTGGCACC

I don't understand why this sequence haven't been trimmed. The contig just has one additional "a", which should be a sequencing error.

Then I added the full vector sequence into the file used for trimming. It seems that the result becomes better this time, although there are still some non-CDNA nucleotides appeared in assembled contigs ( I have aligned some of the contigs to reference sequences, and found some terminal nucleotides failed to be aligned)

I was told the flanking sequences were sufficient for vector trimming, but I observed an improved result by using full vector sequence. Is full vector sequence indeed necessary, or I have made something wrong in vector trimming?


Thanks in advance!
sulicon is offline   Reply With Quote
Old 09-20-2010, 08:02 AM   #2
flxlex
Moderator
 
Location: Oslo, Norway

Join Date: Nov 2008
Posts: 415
Default

This is not good... It's a bug (I'm pretty sure) with newbler that surprises me. You cannot change the parameters for trimming so I am afraid you are out of luck there. If using the full vector helps then use that!

One thing to try is collecting the variant sequences of your primers and using them all in your trimming file, that might help...

Last edited by flxlex; 09-20-2010 at 08:03 AM. Reason: Typo
flxlex is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:04 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO