SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Sanger/Dye Terminator



Similar Threads
Thread Thread Starter Forum Replies Last Post
ligation problem for pcr product aliceli Pacific Biosciences 0 11-04-2014 08:08 PM
Bioruptor shearing of PCR product bernieball Sample Prep / Library Generation 1 11-25-2013 06:37 AM
PCR product quantification vl80 Sample Prep / Library Generation 1 02-15-2013 06:07 AM
PCR product normalization Palecomic Sample Prep / Library Generation 0 01-20-2011 01:50 AM
Request for sequencing of PCR product Damann Core Facilities 0 11-05-2009 07:34 AM

Reply
 
Thread Tools
Old 08-17-2015, 05:05 PM   #1
arkilis
Senior Member
 
Location: Australia

Join Date: Jul 2013
Posts: 119
Default why Hairspin region will affect the PCR product

Hi,

I am doing a primer design recently, and using the primer 3 to do the primer design. But get a warning at the end:

CGGCGCCGAGCCCCGCCGGGGTGAGCTGGG


Which looks like a CGG Hairspin. Many people tell me that *might* cause the pcr amplification failure. But why...

Thanks in advance.
arkilis is offline   Reply With Quote
Old 10-13-2015, 01:50 PM   #2
Angelmass
Member
 
Location: California

Join Date: Jun 2015
Posts: 10
Default

Is this the priming region or the amplicon?

Hairpins cause secondary structure loops cause DNA polymerase slippage, which can cause frameshift mutations in your sequence when undergoing PCR, which obviously you don't want.

If it's the priming region, the secondary structure loop would cause the primer to bind to your DNA inefficiently.

Either way, you would get less amplification than you were expecting. The warning I assume is to stop you from putting together a poorly designed primer.
Angelmass is offline   Reply With Quote
Reply

Tags
hairspin, pcr amplicons, primer desgin

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:04 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO