SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Secondary structure prediction for chimeric DNA-RNA sequences PavelMor Bioinformatics 0 11-06-2018 08:49 AM
RNA secondary structure prediction Schelarina General 0 09-06-2014 11:22 AM
Complexity of amino acid sequence mudit Bioinformatics 0 03-28-2013 02:15 AM
amino acid change effect on protein structure using bioinformatics ketan_bnf Bioinformatics 0 07-20-2011 09:00 PM

Reply
 
Thread Tools
Old 01-30-2019, 12:48 AM   #1
lefleurdumal
Junior Member
 
Location: Houston

Join Date: Jan 2019
Posts: 1
Default Estimation of entropy of an amino acid sequence and secondary structure prediction

Hello everybody,

How do I estimate the entropy of the following sequences?

S1 TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT (36T)

S2 ATCTTGTGCAGTCAGTCTGCCCCGATTGTGTA ( 5A, 8C, 8G e 11T)

Moreover, how do I find sensitivity, specificity and accuracy for the following secondary structure prediction regarding the presence of alpha helix in an aminoacid sequence?

Sperimental data xaaaaaaaaxxxaaaaaaxx
Prediction xxxaaaaxxxxxxaaaaaaa

Thank you!
lefleurdumal is offline   Reply With Quote
Reply

Tags
accuracy, entropy, secondary structure, sensitivity, specificity

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:50 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO