SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
help mapping BS treated illumina reads using rmapbs shawpa Bioinformatics 0 12-06-2011 04:02 AM
MethylCoder: software for bisulfite treated reads brentp Bioinformatics 15 07-07-2011 12:17 PM
Online Bisulfite Alignment programs? hxm44 Bioinformatics 4 05-18-2011 04:11 PM
increase in 3' %T after filtering BS-Treated reads brentp Bioinformatics 2 09-29-2010 06:10 AM
Alignment of ABI solid reads and 454 reads baohua100 Bioinformatics 2 02-23-2009 04:58 PM

Reply
 
Thread Tools
Old 03-22-2010, 02:59 PM   #21
sci_guy
Member
 
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83
Default

Hua used an interesting recursive strategy to map more maps back to the Arabidopsis genome. After aligning she took the unmapped reads and chopping off the first base and the last few bases, then with recursive rounds of aligning and progressively chopping off more 3' end bases got 90% of reads to map. It seems the reads mapped back in the 2nd and later rounds were actually meaningful. Quite impressive.

I also found out Stuart Stephen from the CSIRO plant industry group has also baked up a really nice aligner that is robust to bisulfite. The paper is coming soon...
sci_guy is offline   Reply With Quote
Old 03-22-2010, 03:14 PM   #22
sci_guy
Member
 
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83
Default

I'm reading the GSNAP paper more throughly now as it looks really good for a project I'm involved with - variant detection in a region of linkage.

The last sentence of the introduction is: "The data structures in GSNAP allow it to align BS-seq reads with explicit detection of genomic-T to read-C mismatches, against either a reference sequence or a SNP-tolerant reference space."

From my interpretation GSNAP will penalise improperly converted bisulfite reads, but will not make use of the "C" information present in the read, while BSMAP will happily align improperly converted reads but can make use of "C" information.
sci_guy is offline   Reply With Quote
Old 03-24-2010, 02:07 PM   #23
ondovb
Member
 
Location: Maryland

Join Date: Jan 2010
Posts: 20
Default

Quote:
Originally Posted by sci_guy View Post
From my interpretation GSNAP will penalise improperly converted bisulfite reads, but will not make use of the "C" information present in the read, while BSMAP will happily align improperly converted reads but can make use of "C" information.
The way I read it, they both function similarly in this respect. GSNAP hashes with a reduced alphabet, but will only allow C->T changes when it actually assesses the alignments. So they are both making use of reference C information, but neither of them will know the difference between methylation and incomplete conversion.

As far as I can tell from the papers, they should theoretically have the same sensitivity and specificity with respect to bisulfite changes.
ondovb is offline   Reply With Quote
Old 03-25-2010, 11:37 AM   #24
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

Suppose the original genomic sequence is ACGTTCA and another position has sequence ATGTTCA. The 2nd C is unmethylated. One of the possible reads you can get is ACGTTtA. According to sci_guy's description, BSMAP prefers ACGTTCA in mapping, but gsnap regards the alignment ambiguous.
lh3 is offline   Reply With Quote
Old 03-25-2010, 01:28 PM   #25
ondovb
Member
 
Location: Maryland

Join Date: Jan 2010
Posts: 20
Default

Quote:
Originally Posted by lh3 View Post
Suppose the original genomic sequence is ACGTTCA and another position has sequence ATGTTCA. The 2nd C is unmethylated. One of the possible reads you can get is ACGTTtA. According to sci_guy's description, BSMAP prefers ACGTTCA in mapping, but gsnap regards the alignment ambiguous.
I tried this in GSNAP (you have to pad everything to reach min lengths) and it chose ACGTTCA.

I think the confusion is coming from that last sentence of the intro that sci_guy quoted...when they say "explicit detection", I think they just intended that to mean it can tell T->C apart from C->T, and treat T->C appropriately as an error.
ondovb is offline   Reply With Quote
Old 03-25-2010, 03:36 PM   #26
lh3
Senior Member
 
Location: Boston

Join Date: Feb 2008
Posts: 693
Default

Yes, this makes sense. Thank you, ondovb.
lh3 is offline   Reply With Quote
Old 03-25-2010, 03:41 PM   #27
sci_guy
Member
 
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83
Default

Quote:
Originally Posted by ondovb View Post
I tried this in GSNAP (you have to pad everything to reach min lengths) and it chose ACGTTCA.
Cool. Thanks for that.

There's nothing like empirical data to disprove an hypothesis
sci_guy is offline   Reply With Quote
Old 06-25-2010, 12:46 AM   #28
volks
Member
 
Location: hd.de

Join Date: Jun 2010
Posts: 81
Question

Quote:
Originally Posted by sci_guy View Post
Thanks! I'll take a look. I have more SOLiD data coming my way soon.
hi sci_guy,
any news on this? are there short read aligner other than SOCS2 capable of mapping BS reads in colorspace?
best, volks
volks is offline   Reply With Quote
Old 07-22-2010, 08:21 PM   #29
sci_guy
Member
 
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83
Default

Quote:
Originally Posted by volks View Post
hi sci_guy,
any news on this?
Not that I've heard of.
sci_guy is offline   Reply With Quote
Old 07-23-2010, 12:42 PM   #30
Zigster
(Jeremy Leipzig)
 
Location: Philadelphia, PA

Join Date: May 2009
Posts: 116
Default

has anyone tried BSSeeker?

From what I can tell it is a Bowtie wrapper but not sure how it compares to the others discussed here.
__________________
--
Jeremy Leipzig
Bioinformatics Programmer
--
My blog
Twitter
Zigster is offline   Reply With Quote
Old 09-09-2010, 03:38 AM   #31
aniruddha.otago
Member
 
Location: New Zealand

Join Date: Jan 2010
Posts: 21
Default

did anybody used the BS_SEEKER programme ??? it seems that its faster than BSMAP. I tried to run BSMAP and it really slow. is that normal... anyfeedbacks from the previous users ??
aniruddha.otago is offline   Reply With Quote
Old 09-09-2010, 03:41 AM   #32
aniruddha.otago
Member
 
Location: New Zealand

Join Date: Jan 2010
Posts: 21
Default

I am copying a part of aligned read from BSMAP... Guys pease help how to interpret the methylation from here...... ur feedbacks will help me to have a clearer understanding of the data..
aniruddha.otago is offline   Reply With Quote
Old 09-09-2010, 03:41 AM   #33
aniruddha.otago
Member
 
Location: New Zealand

Join Date: Jan 2010
Posts: 21
Default

I am copying a part of aligned read from BSMAP... Guys pease help how to interpret the methylation from here...... ur feedbacks will help me to have a clearer understanding of the data..




WI-EAS209_0006_FC706VJ:1:1:4692:4450#0/1 GGAGTGATTGTAGTTATGAATTTGATATGTTATTATTATTGTTGTTTGTGTTTTTTTTTTTTTTTTTGTTTTGATTTGGGAAGACAGTT NM
HWI-EAS209_0006_FC706VJ:1:1:4692:16063#0/1 GGAGTAAAAGGGTGAGAATTTATAGGAGGAATTTGTGGTCGATTAAATTTTTTTTTTTGGTTTTTTTTTGTTTTTGGGGGGGGGTTTAT NM
HWI-EAS209_0006_FC706VJ:1:1:4692:4011#0/1 GGGTTACGGAAAGTATATTTTTTGTTTTTTTGGTTTTGTTTGTTTTTGTGTAGTTTTAATAAGTATAGAGTAAGGAATATAATCGGTTT UM gi|29824588|ref|NC_000017.5|NC_000017 6309095 ++ 1 0:1:0:0:0 mC:6309101:6309178
HWI-EAS209_0006_FC706VJ:1:1:4693:4046#0/1 GGTAGGAGGATGGGGGGTTTTATATGGTTTTGTGTTATTTGTTTTATTTTTTTTTGTTTTTTGTGTGTTTTGTGGGGGAGGTTGGTTTT NM
HWI-EAS209_0006_FC706VJ:1:1:4693:10086#0/1 GGTTTTTTGGTTTTGTTATTCGTTAGTTTGGTTTGTTTTTGGTGATAGGGGGGGGGGGGCGTTTTTTTTTGTTTTTTTTTTTTTTTTTT NM
HWI-EAS209_0006_FC706VJ:1:1:4693:5806#0/1 GGAAGGTGTGGGTGGGTTGTTGATGGTGTTGTTTAGGGTATTTGGGGGTTTGAGATCGGAAGAGGGGTTCGGCGGGAATCCGGAGCCCG NM
HWI-EAS209_0006_FC706VJ:1:1:4693:6145#0/1 GGATGTTGGGTTGTTTTTGGGGGTGGGTGGTGATTTGTGGGGTTTGGGTTGTGTTTTTTGGTTTTTTTTTTTTTTTTTTTTTTTTTTTT NM
HWI-EAS209_0006_FC706VJ:1:1:4693:14513#0/1 GGATGATGTGTGGATTTTTGTGATTTTTGGGTTGGGATTTTTAATTGTTTGGGTTTTTTTGAGTTGGGAAGGGCGTTTCGGCGGGATTG NM
HWI-EAS209_0006_FC706VJ:1:1:4693:16592#0/1 ATTAAAGAGGTTAGGTATGGTGGTTTATGTTTGTAATTTTAGTATTTTGGGAGGTTGTGGGGGTGGTTTTTGGGGTTTTGGTTTTAGGT NM
HWI-EAS209_0006_FC706VJ:1:1:4693:2886#0/1 GGTTGGGGTAATTTAAAATTATATTTATTGGGTATATGTTTTTTTTTTTTTTTTATTTTGTTTTTTTTTTTGGTTGGTTTTTTTTTTGG NM
HWI-EAS209_0006_FC706VJ:1:1:4693:11171#0/1 GGGAATTTTGTTTTGTATTGTTGTGTATTTGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGACCTCGTATTCTGTCTTCTGT NM
HWI-EAS209_0006_FC706VJ:1:1:4693:11425#0/1 GGATTGCGGATTGTAGTGGCGTAATTTCGGTTTTTTGTAAGTTTCGTTTTTTGGGACCGGAAGGGCGGTTCGCGGGCATGCCGAGACCG NM
HWI-EAS209_0006_FC706VJ:1:1:4693:16325#0/1 GGAAGGTTTAGAATTTTTCGTATAATTGTGGGGTTAGGAGATTCGTAATATAGGTTTTTTTGGTTGCGTTGGGTGTCTGGGTGGTTGGT NM
HWI-EAS209_0006_FC706VJ:1:1:4693:18498#0/1 GGTAGTAGTTTTAGTGGTGTAGTTAGGTTATGGATATGTTTTTTTTTTTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTTTTTTTTT NM
HWI-EAS209_0006_FC706VJ:1:1:4694:15719#0/1 GGTAATTATTGTTTGTTTTTTGGAGTTGTTGTTTGGGTAGGGGTGGTTTTGGTTTTTTTTTGTTTGGACGGGGAGGGGGGTTTGGGGGG NM
HWI-EAS209_0006_FC706VJ:1:1:4694:15747#0/1 GGATTGGTGTTTGTTTAGGTTATTGTTTTTGTGTTTGGTGTTGGTGGCGGGGTTGAGATGGGAAGGGGGGTTCCGCGGGACTGCGGAGC NM
HWI-EAS209_0006_FC706VJ:1:1:4694:20404#0/1 GGTTTTTTTTTTAAAAGTAGTTATGAGTAGATAAGTTTAGAAAGGGTTTTTTTTTCGTGTTTTTTTGGGGAAAATAGGGAAGGTTAATT NM
HWI-EAS209_0006_FC706VJ:1:1:4694:8674#0/1 GGTTGGGTTTTAGGTTGGAGTATGGTTGAGTTTTGTTTTTGTTTTTTTATTTGTTGGGGGGGGATTAAGTTATGTTTTTTTTTGTGGTT NM
HWI-EAS209_0006_FC706VJ:1:1:4694:19397#0/1 GGAGATTTTGGTTTTTTTAGGTTTTTTTTTGATTTAAATAAAAGTTGAGATCGGAAGAGCGGTTCAGCGGGAATGCCGAGCCCGTTTTG NM
HWI-EAS209_0006_FC706VJ:1:1:4694:17742#0/1 GGAATGGGTTGTGTTTTTTTGTTTTATTTGATTTAGTTAATGAATGTTGAGTATTTTTTTTGTTTAGGGTTTTGGGTTGGGAGGGGGGT NM
HWI-EAS209_0006_FC706VJ:1:1:4694:8920#0/1 GGGTTTAAGAGATTTTTTTGTTTTAGTTTTTTAAATAGTTGGGATTATAGGTATTTGTTTTTATGTTTGAGATCGGAAGAGCGGTTCAG NM
HWI-EAS209_0006_FC706VJ:1:1:4695:6571#0/1 GGGGGTTTTAGATTTGAATTAGGTTCGTCGGTTTTTTGTTGGTTGGGGGTTTTGTTTGGGTTTTTTTTTTTTTTTTTTTTTTTTGGTTT NM
HWI-EAS209_0006_FC706VJ:1:1:4695:5587#0/1 GGGAGTAGTTTTTTTTGTTTGTGTACGTTCGTATTTAGTAGATCGGAAGAGCGGTTCAGCAGAATGCCGAGACCGATCTCGTATCCCGT NM
HWI-EAS209_0006_FC706VJ:1:1:4695:8464#0/1 GGAATTTGTTTTTTAGCGGAGATAATGAGTTTTATTTATTTAGTTTAGGTAAGTGTCGGTCGTGGGTGGGGTATTTTGGTTTTTTTTTT UM gi|29824582|ref|NC_000011.4|NC_000011 3109475 -+ 4 0:0:0:0:1 mC:3109547:3109507:3109503
HWI-EAS209_0006_FC706VJ:1:1:4696:19770#0/1 GGGTATAGTGGTTTATATTTGTAATTTTAGTATTTTGGGAGGTTGAGGTAGGAAGATTATTTGAGTTTAGAAGAATAGTTCGGGTATTT UM gi|29824574|ref|NC_000003.5|NC_000003 45458886 -+ 2 0:0:1:0:0 mC
aniruddha.otago is offline   Reply With Quote
Old 09-09-2010, 08:42 PM   #34
aniruddha.otago
Member
 
Location: New Zealand

Join Date: Jan 2010
Posts: 21
Default

hi is there any feedback on my above query....
aniruddha.otago is offline   Reply With Quote
Old 09-09-2010, 09:01 PM   #35
ECO
--Site Admin--
 
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,357
Default

Hey. Welcome. Please don't constantly bump your thread. Give it some time and search the site for your answer.
ECO is offline   Reply With Quote
Old 09-10-2010, 07:05 AM   #36
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 614
Default

Hi aniruddha.otago,

I am afraid I can't help you with interpreting the results from BSMAP, the output is probably described in the manual.

However I would like to point out that we have developed a BS-Seq mapping program called Bismark, which is easy to use, runs very fast and it performs methylation calling (in CpG, CHG and CHG context) in addition to just aligning the reads. Thus, its output is easy to handle and interpret and doesn't require you to start programming before you can have a look at the methylation data.

For more information please visit www.bioinformatics.bbsrc.ac.uk/projects/bismark/ or search SEQanswers (and the SeqWiki) for Bismark.

In case you need any help just drop me an email.

Best wishes,
Felix
fkrueger is offline   Reply With Quote
Old 09-22-2010, 08:02 PM   #37
aniruddha.otago
Member
 
Location: New Zealand

Join Date: Jan 2010
Posts: 21
Default

Hi felix,

send you an email. Please reply.
aniruddha.otago is offline   Reply With Quote
Old 09-23-2010, 07:39 AM   #38
fkrueger
Senior Member
 
Location: Cambridge, UK

Join Date: Sep 2009
Posts: 614
Default

You've got mail.

Kind regards,
Felix
fkrueger is offline   Reply With Quote
Old 11-17-2010, 05:51 PM   #39
zeam
Member
 
Location: USA

Join Date: Oct 2010
Posts: 37
Default

Quote:
Originally Posted by sci_guy View Post
@lh3. I'm going to workshop over the next couple of days. It seems somebody else in my organisation has been using BSMAP with Arabidopsis bisulphite-Seq data. Below is their talk abstract. BSMAP would be particularly good for plant genomes considering all the CNG and CNN methylation. I'll see if I can get any slides.

"Hua Ying (CSIRO)
Approaches to mapping high-throughput bisulfite sequencing reads: High-throughput bisulfite sequencing is an attractive approach for analyzing genome-wide methylation patterns at a single-base-pair resolution. Although combining bisulfite conversion and high-throughput sequencing is increasingly widespread, its analysis is still problematic and limited to a few publications. A major challenge is the alignment of bisulfite-converted short reads to the reference genome due to increased search space and reduced sequence complexity as a result of the bisulfite conversion. Here, we took advantage of a recently published mapping algorithm BSMAP and demonstrated that BSMAP is more effective than previously used methods. By applying a two-step mapping strategy, we successfully mapped more than 90% of bisulfite short reads to the Arabidopsis genome."
Hi,there.You've mentioned "I'll see if I can get any slides.",and have you get the slides yet? If you have,Could you send a copy to me?I'm working on datas generated by BS_seq.THANKS!
Or could you give the e-mail adress of Hua Ying?My email:zeamxie@hotmail.com.
zeam is offline   Reply With Quote
Old 01-10-2011, 10:10 PM   #40
sparks
Senior Member
 
Location: Kuala Lumpur, Malaysia

Join Date: Mar 2008
Posts: 126
Default

Hi,
I know this an old thread but I'd like to give an update on Novoalign bisulphite mode for those still interested.
Firstly Novoalign's algorithm is similar to BSMAP in that cytosines are retained in reads during alignment. The alignment works by converting Cs in the reference to CT dinucleotides just before alignment so a C or T in read will align with no penalty when aligned to a CT but Cs in read will mismatch a T in the reference. For negative strand alignments we do G to GA conversion.
In the next release V2.07.06 which should be out this week we've added a new program novomethyl that will call methylated cytosines from a SAM file. It's basically a samtools pileup with a SOAP SNP/Consensus calling algorithm that calls 6 nucelotide states (A, Cu, Cm, Gu, Gm, T ) rather than usual 4. Output is in form of a bed file.
To support this we also added a new tag in SAM format to indicate if read was aligned on Watson or Crick strand (i.e. in CT or GA mode)
If you'd like to try it we do give 1 month trial licences for free.
Colin
Novocraft Tech.
sparks is offline   Reply With Quote
Reply

Tags
alignment, bisulfite, methylation

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:23 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO