SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
Ion S5 adaptors JoF Ion Torrent 0 01-14-2016 06:02 AM
Adaptors for MeDIP-seq nouba Illumina/Solexa 5 05-02-2014 10:59 AM
Remove adaptors zshu Illumina/Solexa 2 11-29-2012 12:31 AM
TruSeq Adaptors reported by FastQC are true adaptors? Jiafen Bioinformatics 3 11-07-2012 02:07 PM
primers and adaptors xgm-1999 454 Pyrosequencing 2 09-22-2009 01:24 AM

Reply
 
Thread Tools
Old 08-25-2017, 08:08 AM   #1
cement_head
Senior Member
 
Location: Oxford, Ohio

Join Date: Mar 2012
Posts: 188
Question PE Adaptors

In the lastest Illumina Sequence Letter, the Paired End DNA Oligonucleotides are now listed as "Obsolete". Does that mean/imply that they will no longer work on HiSeq2500 (and MiSeq) flow cells?

Code:
Oligonucleotide Sequences for Paired End DNA
(Obsolete)
PE Adapters
5' P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 1.0
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE PCR Primer 2.0
5' CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
PE Read 1 Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
PE Read 2 Sequencing Primer
5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
cement_head is offline   Reply With Quote
Old 08-25-2017, 11:39 AM   #2
cement_head
Senior Member
 
Location: Oxford, Ohio

Join Date: Mar 2012
Posts: 188
Default

No, it means that Illumina no longer "SELLS" these adaptors...
cement_head is offline   Reply With Quote
Reply

Tags
pe adaptors

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:23 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO