SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
Oligo dT VN hewenjuan Sample Prep / Library Generation 2 10-17-2017 06:34 AM
Questions about RADseq oligo barn88 Sample Prep / Library Generation 2 08-05-2017 10:57 AM
dsRNA oligo concentration Palgrave General 6 10-27-2015 10:19 PM
getting genotypes with oligo package [email protected] Bioinformatics 2 07-03-2013 09:46 AM
Oligo quality issue HMorrison General 5 12-02-2011 01:04 PM

Reply
 
Thread Tools
Old 10-03-2017, 02:45 PM   #1
hewenjuan
Junior Member
 
Location: San Francisco

Join Date: Sep 2017
Posts: 7
Default * in an oligo sequence

What does "*" mean in an oligo sequence?
e.g. 5’AATGATACGGCGACCACCGAGATCTACACGCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGT*A*C

Thanks!!
hewenjuan is offline   Reply With Quote
Old 10-03-2017, 06:01 PM   #2
luc
Senior Member
 
Location: US

Join Date: Dec 2010
Posts: 308
Default

The bonds between these bases are phosphorothioated to prevent nuclease digestion (e.g. from proofreading polymerases) : https://www.idtdna.com/site/Catalog/...ons/Category/8
luc is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:12 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO