SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Tophat-fusion-post error AsoBioInfo Bioinformatics 4 12-23-2014 02:19 AM
TopHat Fusion post (Error) samar Bioinformatics 5 07-14-2014 10:52 PM
Tophat-fusion-post error dadada4ever Bioinformatics 9 08-05-2013 07:40 PM
Tophat2 with fusion search and tophat-fusion-post problems seqfast Bioinformatics 9 07-30-2013 07:16 PM
tophat-fusion-post:known fusions? mrfox Bioinformatics 0 01-19-2012 09:04 AM

Reply
 
Thread Tools
Old 07-16-2013, 03:53 AM   #1
mknut
Member
 
Location: UK

Join Date: Jul 2012
Posts: 23
Default Tophat Fusion Post Processing filtering out confirmed positive fusion

I have been investigating a set of RNA-seq samples with known, confirmed fusions with Tophat-Fusion, in order to check efficacy of the tool and our pipeline. 4/5 fusions in different samples have been detected successfully. The fifth one was initially detected by Tophat (i.e. it is listed in fusions.out), but it was filtered out by post processing. I am trying to figure out why.

I have checked specificity of the fusion site manually with BLAST and the highest score I found was 110(length+identity percent), below the cut-off of 160.

The fusion is well anchored into both sites, and it also has sufficient number of supporting reads, pairs, and spanning pairs, as seen in its details, taken from fusions.out:
Code:
chr5-chr12      149510224       12006494        fr      38      13      19      0       86      79      0.546399        @       11 25 38 52 66  @       TTCCCCACTGTCAGGGTGGCTCTCACTTAGCTCCAGCACTCGGACAGGGA CTGCATGGAGAGAGCACTGAGTTAGGAGGCGGGAGGGTCAGGACAGTTAA   @       CCTGGATTTGTCTAAACCTCAGGCAAGAAAAGAGAAACCTCTTCCAGTAC CTTCTTCATGGTTCTGATGCAGTATGACCTCCGGCTGTGTGTGTATAGAG   @       38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 38 37 37 37 37 36 36 36 36 35 35 34 34 34 34 34 34 32 32 31 31 31 31 30 28 25 24 23 22 20   @       38 38 38 38 38 38 38 38 38 38 38 38 38 38 37 37 37 37 37 37 37 36 35 35 35 35 35 35 34 33 33 33 32 30 30 27 26 24 23 23 23 22 22 21 21 21 21 20 20 19   @       11:7 32:2 22:43 82:2 43:70 29:97 72:69 114:97 114:97 727:31 880:29 4046:105 5235:105
I had a look at the source code of tophat-fusion-post, and unfortunately I cannot find any indication as to why this specific fusion was filtered out.
Its check log does not exist in tophatfusion_out/check/

Commands used:
Tophat:
Code:
tophat -o tophat_sample_282 -p 8 --fusion-search --keep-fasta-order --bowtie1 --no-coverage-search -r 0 --mate-std-dev 80 --max-intron-length 100000 --fusion-min-dist 100000 --fusion-anchor-length 13 --fusion-ignore-chromosomes chrM /scratch/EXOME_DATA/RNASEQ/index_bowtie1/hg19 /scratch/EXOME_DATA/RNASEQ/positive_control_WTCHG/tophat/sample_282/WTCHG_cat_282_1.fastq /scratch/EXOME_DATA/RNASEQ/positive_control_WTCHG/tophat/sample_282/WTCHG_cat_282_2.fastq
Post processing:
Code:
tophat-fusion-post -p 8 --num-fusion-reads 1 --num-fusion-pairs 2 --num-fusion-both 5 /scratch/EXOME_DATA/RNASEQ/index_combined/hg19
Software versions:
Bowtie 0.12.8
Tophat 2.0.6
Blast 2.2.25
Samtools 0.1.18

I have emailed the creators of Tuxedo suite, and will post here if I get a reply.

Maybe there is something I am forgetting about? Some post processing condition that this specific fusion does not meet? Any help would be greatly appreciated.
mknut is offline   Reply With Quote
Old 12-03-2013, 11:20 AM   #2
NKAkers
Member
 
Location: New York, NY

Join Date: Sep 2011
Posts: 26
Default

Did you ever get an answer to this? I'm encountering something similar, I'd be interesting in hearing what you found.
NKAkers is offline   Reply With Quote
Old 01-09-2014, 08:00 AM   #3
mknut
Member
 
Location: UK

Join Date: Jul 2012
Posts: 23
Default

Nothing at all, sorry.
mknut is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:36 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO