SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
NCBI Reference Sequence ID to refseq accession carolW Bioinformatics 15 02-02-2015 02:01 PM
How does NCBI populate data fro gene entries? I want to get all refseq mRNA.. beeman Bioinformatics 3 05-11-2014 04:36 PM
Get Promoter Sequence for List of RefSeq IDs Fernas Bioinformatics 1 07-29-2013 03:14 PM
Refseq ID for mRNA and protein sehrrot Bioinformatics 0 03-25-2013 04:54 AM
BWA parameters for mRNA-seq aligning against mRNA refseq kwicher SOLiD 1 09-19-2011 03:45 AM

Reply
 
Thread Tools
Old 11-23-2015, 05:33 AM   #1
xiangwulu
Member
 
Location: ireland

Join Date: Apr 2014
Posts: 18
Default Non A T G C base in RefSeq zebrafish mRNA sequence

I found some non A T C G base in refseq zebrafish mRNA sequence:
'Y', 'K', 'R', 'M', 'W'

couldn't find out what do they mean.

e.g.
NM_001012366.1
http://www.ncbi.nlm.nih.gov/nuccore/...5?report=fasta
at line:
CCCCCACAGTCCCTGCATTACGGGAATGTGCAGGCAAGAGGAAGCGGTCTCAGGGAGAGGAGGMCGAAGG

this is causing error for some alignment tool, such as bfast.

Thanks.

Last edited by xiangwulu; 11-23-2015 at 05:34 AM. Reason: typo
xiangwulu is offline   Reply With Quote
Old 11-23-2015, 05:41 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,076
Default

Look at IUPAC codes for degenerate nucleotides: https://en.wikipedia.org/wiki/Nucleic_acid_notation
GenoMax is offline   Reply With Quote
Old 11-23-2015, 05:58 AM   #3
xiangwulu
Member
 
Location: ireland

Join Date: Apr 2014
Posts: 18
Default

thanks very much.
xiangwulu is offline   Reply With Quote
Old 11-23-2015, 08:13 AM   #4
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

You can use Reformat with the iupacton flag to turn non-ACGT symbols to N, like this:

reformat.sh in=mrna.fasta out=reformatted.fasta iupacton
Brian Bushnell is offline   Reply With Quote
Reply

Tags
sequence analysis

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:54 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO