SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
using primer3+ design primers received a warning? arkilis Bioinformatics 0 04-30-2015 04:55 PM
Primer3 primer dimer score ingridejt Illumina/Solexa 0 10-23-2014 05:29 AM
primer3 krunal Bioinformatics 3 05-26-2014 04:08 AM
Failed Sample QC Kates106 Bioinformatics 2 09-09-2013 12:08 PM
pacbioToCA failed shiningway Bioinformatics 3 02-28-2013 03:47 PM

Reply
 
Thread Tools
Old 02-16-2016, 03:50 PM   #1
Daniel Fernandez
Member
 
Location: Lima. Perú

Join Date: Nov 2011
Posts: 31
Default Primer3 primer3_core failed (SOLVED)

Hi, I select 11 microsatellites generated by MISA program (http://pgrc.ipk-gatersleben.de/misa/), now I want to design primer, and I use this.

Code:
misa.pl FASTA.fa
p3_in.pl FASTA.fa.misa
primer3_core < FASTA.fa.p3in > FASTA.fa.p3out
p3_out.pl FASTA.fa.p3out FASTA.fa.misa
But the outgoing message is

Code:
11 record was created.
Use of uninitialized value $count in concatenation (.) or string at ./p3_out.pl line 76, <SRC> chunk 11.
Primer modelling was succefull for sequences.
Primer modelling failed for 11 sequences.
I chek the *.misa file, all is OK, but the problem is with primer3_core (I suppose) with the message "Use of uninitialized value $count in concatenation (.) or string at ./p3_out.pl line 76" and in the end with p3_out.pl the *.result show the SSR, SSR type but not the primers sequences.

PD: I want to use the program and not the online service because after I have to do the same proces but with a genome and selec more than 100 microsatellites.

Last edited by Daniel Fernandez; 02-21-2016 at 06:43 AM. Reason: SOLVED
Daniel Fernandez is offline   Reply With Quote
Old 02-17-2016, 08:39 AM   #2
piet
Member
 
Location: planet earth

Join Date: Aug 2014
Posts: 21
Default

Quote:
Originally Posted by Daniel Fernandez View Post
I chek the *.misa file, all is OK, but the problem is with primer3_core (I suppose) with the message "Use of uninitialized value $count in concatenation (.) or string at ./p3_out.pl line 76" and in the end with p3_out.pl the *.result show the SSR, SSR type but not the primers sequences.
primer3_core is a compiled C program, it does not have variables like $count. The error message is definitely emitted by one of your Perl programs. Please run the 4 commands in an interactive shell, one after each other. Then you will see, which command throws the error.
piet is offline   Reply With Quote
Old 02-17-2016, 01:24 PM   #3
Daniel Fernandez
Member
 
Location: Lima. Perú

Join Date: Nov 2011
Posts: 31
Default

Quote:
Originally Posted by piet View Post
primer3_core is a compiled C program, it does not have variables like $count. The error message is definitely emitted by one of your Perl programs. Please run the 4 commands in an interactive shell, one after each other. Then you will see, which command throws the error.
Yes you're right, the problem is in ./p3_out.pl FASTA.fa.p3out FASTA.fa.misa

It show me this:

Code:
Use for uninitialized value $count in concatenation (.) or string at ./p3_out.pl line 76, <SRC> chunk 11.
Primer modelling was succesfull for sequences.
Primer modelling failed for 11 sequences.
What can I do?
Daniel Fernandez is offline   Reply With Quote
Old 02-17-2016, 01:32 PM   #4
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

Start looking at FASTA.fa.p3out FASTA.fa.misa files to make sure that they are not empty or have some other issues in terms of format/content.
GenoMax is offline   Reply With Quote
Old 02-18-2016, 05:31 AM   #5
Daniel Fernandez
Member
 
Location: Lima. Perú

Join Date: Nov 2011
Posts: 31
Default

The *.misa file is Ok:

Code:
ID	SSR nr.	SSR type	SSR	size	start	end
Seq	1	p2	(TA)7	14	8423	8436
Seq	2	p2	(AC)8	16	21149	21164
Seq	3	c	(AT)13(GT)10	46	21525	21570
Seq	4	c	(GAAA)16g(AAGA)12aaaagaaagaaaa(AAAG)5aaaaa(AAGG)5	171	24719	24889
Seq	5	p2	(AC)15	30	31040	31069
Seq	6	c	(TG)20ta(TG)7	56	51867	51922
Seq	7	p4	(ATAG)14	56	71616	71671
Seq	8	p2	(AT)8	16	76892	76907
Seq	9	c	(AAGA)16agaaagaagaagaagaagaagaaagaagaaagg(AAGA)21	181	84544	84724
Seq	10	p5	(AAAAC)6	30	85025	85054
Seq	11	p4	(GAAG)5	20	88643	88662
The *.p3out is this (I remove the sequence to show) 11 times the same.

Code:
PRIMER_SEQUENCE_ID=Seq_1
SEQUENCE=AAAT ...CATC
PRIMER_PRODUCT_SIZE_RANGE=100-280
TARGET=8420,20
PRIMER_MAX_END_STABILITY=250
=
And the *p3out is this (show the error) 11 times the same.

Code:
PRIMER_SEQUENCE_ID=Seq_1
SEQUENCE=AAAT ...CATC
PRIMER_PRODUCT_SIZE_RANGE=100-280
TARGET=8420,20
PRIMER_MAX_END_STABILITY=250
PRIMER_ERROR=Missing SEQUENCE tag
=
Daniel Fernandez is offline   Reply With Quote
Old 02-18-2016, 08:22 AM   #6
piet
Member
 
Location: planet earth

Join Date: Aug 2014
Posts: 21
Default

Quote:
Originally Posted by Daniel Fernandez View Post
Code:
PRIMER_ERROR=Missing SEQUENCE tag
=
That means that primer3_core is complaining about missing SEQUENCE in its input file. Due to this, it has not found any primers. Then 'p3_out.pl' reads the output and cannot handle the case, that primer3 has not found any primers.

Google-ing the primary error message "PRIMER_ERROR=Missing SEQUENCE tag" leads to a report of another user who has run into the same error in 2009, http://generic-model-organism-system...-td457437.html

It seems that your version of primer3 is too new for your Perl scripts. You can fix this by simply replacing "SEQUENCE=" by "SEQUENCE_TEMPLATE=" in the primer3 input file ('FASTA.fa.p3in').

Code:
sed 's/^SEQUENCE=/SEQUENCE_TEMPLATE=/' FASTA.fa.p3in | primer3_core > FASTA.fa.p3out

Last edited by piet; 02-18-2016 at 08:29 AM.
piet is offline   Reply With Quote
Old 02-18-2016, 06:29 PM   #7
Daniel Fernandez
Member
 
Location: Lima. Perú

Join Date: Nov 2011
Posts: 31
Default

yes! now when I run primer3_core the *.p3out show me the primers:

But when I run p3_out.pl the *.result file doesn't show me the complete table with the primers:

Code:
./p3_out.pl FASTA.fa.p3out FASTA.fa.misa
Use of uninitialized value $count in concatenation (.) or string at ./p3_out.pl line 76, <SRC> chunk 11.

Primer modelling was successful for  sequences.
Primer modelling failed for 11 sequences.
The *.p3out file now is OK:
Code:
PRIMER_SEQUENCE_ID=Sequence_1
SEQUENCE_TEMPLATE=AAAT...
PRIMER_PRODUCT_SIZE_RANGE=100-280
TARGET=8420,20
PRIMER_MAX_END_STABILITY=250
PRIMER_LEFT_NUM_RETURNED=5
PRIMER_RIGHT_NUM_RETURNED=5
PRIMER_INTERNAL_NUM_RETURNED=0
PRIMER_PAIR_NUM_RETURNED=5
PRIMER_PAIR_0_PENALTY=0.056998
PRIMER_LEFT_0_PENALTY=0.030195
PRIMER_RIGHT_0_PENALTY=0.026803
PRIMER_LEFT_0_SEQUENCE=TCCTCATCCCAGCCCATGTA
PRIMER_RIGHT_0_SEQUENCE=GCGGATTGATGCTCGTTGAC
PRIMER_LEFT_0=88310,20
PRIMER_RIGHT_0=88413,20
PRIMER_LEFT_0_TM=60.030
PRIMER_RIGHT_0_TM=59.973
PRIMER_LEFT_0_GC_PERCENT=55.000
PRIMER_RIGHT_0_GC_PERCENT=55.000
PRIMER_LEFT_0_SELF_ANY_TH=0.00
PRIMER_RIGHT_0_SELF_ANY_TH=0.00
PRIMER_LEFT_0_SELF_END_TH=0.00
PRIMER_RIGHT_0_SELF_END_TH=0.00
PRIMER_LEFT_0_HAIRPIN_TH=0.00
PRIMER_RIGHT_0_HAIRPIN_TH=0.00
PRIMER_LEFT_0_END_STABILITY=2.2900
PRIMER_RIGHT_0_END_STABILITY=3.1800
PRIMER_PAIR_0_COMPL_ANY_TH=0.00
PRIMER_PAIR_0_COMPL_END_TH=0.00
PRIMER_PAIR_0_PRODUCT_SIZE=104
PRIMER_PAIR_1_PENALTY=0.057388
PRIMER_LEFT_1_PENALTY=0.030195
PRIMER_RIGHT_1_PENALTY=0.027194
PRIMER_LEFT_1_SEQUENCE=TCCTCATCCCAGCCCATGTA
PRIMER_RIGHT_1_SEQUENCE=CTGCGGATTGATGCTCGTTG
PRIMER_LEFT_1=88310,20
PRIMER_RIGHT_1=88415,20
PRIMER_LEFT_1_TM=60.030
PRIMER_RIGHT_1_TM=59.973
PRIMER_LEFT_1_GC_PERCENT=55.000
PRIMER_RIGHT_1_GC_PERCENT=55.000
PRIMER_LEFT_1_SELF_ANY_TH=0.00
PRIMER_RIGHT_1_SELF_ANY_TH=0.00
PRIMER_LEFT_1_SELF_END_TH=0.00
PRIMER_RIGHT_1_SELF_END_TH=0.00
PRIMER_LEFT_1_HAIRPIN_TH=0.00
PRIMER_RIGHT_1_HAIRPIN_TH=0.00
PRIMER_LEFT_1_END_STABILITY=2.2900
PRIMER_RIGHT_1_END_STABILITY=4.1000
PRIMER_PAIR_1_COMPL_ANY_TH=0.00
PRIMER_PAIR_1_COMPL_END_TH=0.00
PRIMER_PAIR_1_PRODUCT_SIZE=106
PRIMER_PAIR_2_PENALTY=0.061380
PRIMER_LEFT_2_PENALTY=0.034186
PRIMER_RIGHT_2_PENALTY=0.027194
PRIMER_LEFT_2_SEQUENCE=TCCCAGCCCATGTAAGCAAG
PRIMER_RIGHT_2_SEQUENCE=CTGCGGATTGATGCTCGTTG
PRIMER_LEFT_2=88316,20
PRIMER_RIGHT_2=88415,20
PRIMER_LEFT_2_TM=60.034
PRIMER_RIGHT_2_TM=59.973
PRIMER_LEFT_2_GC_PERCENT=55.000
PRIMER_RIGHT_2_GC_PERCENT=55.000
PRIMER_LEFT_2_SELF_ANY_TH=0.00
PRIMER_RIGHT_2_SELF_ANY_TH=0.00
PRIMER_LEFT_2_SELF_END_TH=0.00
PRIMER_RIGHT_2_SELF_END_TH=0.00
PRIMER_LEFT_2_HAIRPIN_TH=0.00
PRIMER_RIGHT_2_HAIRPIN_TH=0.00
PRIMER_LEFT_2_END_STABILITY=4.0100
PRIMER_RIGHT_2_END_STABILITY=4.1000
PRIMER_PAIR_2_COMPL_ANY_TH=0.00
PRIMER_PAIR_2_COMPL_END_TH=0.00
PRIMER_PAIR_2_PRODUCT_SIZE=100
PRIMER_PAIR_3_PENALTY=0.061419
PRIMER_LEFT_3_PENALTY=0.026803
PRIMER_RIGHT_3_PENALTY=0.034616
PRIMER_LEFT_3_SEQUENCE=GTCAACGAGCATCAATCCGC
PRIMER_RIGHT_3_SEQUENCE=AGAGTGTTGCAGGCTCTCAC
PRIMER_LEFT_3=88394,20
PRIMER_RIGHT_3=88563,20
PRIMER_LEFT_3_TM=59.973
PRIMER_RIGHT_3_TM=59.965
PRIMER_LEFT_3_GC_PERCENT=55.000
PRIMER_RIGHT_3_GC_PERCENT=55.000
PRIMER_LEFT_3_SELF_ANY_TH=0.00
PRIMER_RIGHT_3_SELF_ANY_TH=18.19
PRIMER_LEFT_3_SELF_END_TH=0.00
PRIMER_RIGHT_3_SELF_END_TH=9.32
PRIMER_LEFT_3_HAIRPIN_TH=0.00
PRIMER_RIGHT_3_HAIRPIN_TH=34.86
PRIMER_LEFT_3_END_STABILITY=5.5400
PRIMER_RIGHT_3_END_STABILITY=3.5100
PRIMER_PAIR_3_COMPL_ANY_TH=0.00
PRIMER_PAIR_3_COMPL_END_TH=0.00
PRIMER_PAIR_3_PRODUCT_SIZE=170
PRIMER_PAIR_4_PENALTY=0.061810
PRIMER_LEFT_4_PENALTY=0.027194
PRIMER_RIGHT_4_PENALTY=0.034616
PRIMER_LEFT_4_SEQUENCE=CAACGAGCATCAATCCGCAG
PRIMER_RIGHT_4_SEQUENCE=AGAGTGTTGCAGGCTCTCAC
PRIMER_LEFT_4=88396,20
PRIMER_RIGHT_4=88563,20
PRIMER_LEFT_4_TM=59.973
PRIMER_RIGHT_4_TM=59.965
PRIMER_LEFT_4_GC_PERCENT=55.000
PRIMER_RIGHT_4_GC_PERCENT=55.000
PRIMER_LEFT_4_SELF_ANY_TH=0.00
PRIMER_RIGHT_4_SELF_ANY_TH=18.19
PRIMER_LEFT_4_SELF_END_TH=0.00
PRIMER_RIGHT_4_SELF_END_TH=9.32
PRIMER_LEFT_4_HAIRPIN_TH=0.00
PRIMER_RIGHT_4_HAIRPIN_TH=34.86
PRIMER_LEFT_4_END_STABILITY=5.1800
PRIMER_RIGHT_4_END_STABILITY=3.5100
PRIMER_PAIR_4_COMPL_ANY_TH=3.02
PRIMER_PAIR_4_COMPL_END_TH=0.00
PRIMER_PAIR_4_PRODUCT_SIZE=168
=
Daniel Fernandez is offline   Reply With Quote
Old 02-19-2016, 05:58 AM   #8
piet
Member
 
Location: planet earth

Join Date: Aug 2014
Posts: 21
Default

Try to change the tag 'SEQUENCE_TEMPLATE' back to 'SEQUENCE' before you run 'p3_out.pl'. Maybe the missing 'SEQUENCE' causes the failure of 'p3_out.pl'.

Code:
sed 's/^SEQUENCE_TEMPLATE=/SEQUENCE=/' FASTA.fa.p3out > FASTA.fa.p3out2
p3_out.pl FASTA.fa.p3out2 FASTA.fa.misa
piet is offline   Reply With Quote
Old 02-19-2016, 06:48 AM   #9
Daniel Fernandez
Member
 
Location: Lima. Perú

Join Date: Nov 2011
Posts: 31
Default

I did that, but it show me the same

Code:
Use of uninitialized value $count in concatenation (.) or string at ./p3_out.pl line 76, <SRC> chunk 11.

Primer modelling was successful for  sequences.
Primer modelling failed for 11 sequences.
Daniel Fernandez is offline   Reply With Quote
Old 02-20-2016, 01:46 AM   #10
piet
Member
 
Location: planet earth

Join Date: Aug 2014
Posts: 21
Default

Maybe more tags have changed name with the newer versions. Try an older version of primer3, 0.9 definitely shows the old behaviour. Tarballs are still available for download.

http://bioinfo.ut.ee/primer3-0.4.0/p..._releases.html

Last edited by piet; 02-20-2016 at 01:49 AM.
piet is offline   Reply With Quote
Old 02-21-2016, 06:39 AM   #11
Daniel Fernandez
Member
 
Location: Lima. Perú

Join Date: Nov 2011
Posts: 31
Default

I try to install it in my laptop but in the process it show me error, I used biolinux in my lab, it have installed by default.
Well with the *.p3out I extract the primers and other parameters with egrep command.
Thank you very much Piet.

If someone has the same problem

Quote:
misa.pl FASTA.fa
p3_in.pl FASTA.fa.misa

# replace SEQUENCE by SEQUENCE_TEMPLATE
sed 's/^SEQUENCE=/SEQUENCE_TEMPLATE=/' FASTA.fa.p3in > FASTA.fa.p3in2

primer3_core < FASTA.fa.p3in2 > FASTA.fa.p3out

# It should work
sed 's/^SEQUENCE_TEMPLATE=/SEQUENCE=/' FASTA.fa.p3out > FASTA.fa.p3out2
p3_out.pl FASTA.fa.p3out2 FASTA.fa.misa

# If the above step doesn't show results correctly try this
egrep "PRIMER_LEFT_0_SEQUENCE" FASTA.fa.p3out
# the same with this words
PRIMER_RIGHT_0_SEQUENCE
PRIMER_LEFT_0_TM
PRIMER_RIGHT_0_TM
PRIMER_PAIR_0_PRODUCT_SIZE
Daniel Fernandez is offline   Reply With Quote
Old 05-05-2016, 06:54 PM   #12
cdseq
Junior Member
 
Location: Los Banos

Join Date: May 2016
Posts: 3
Default

Quote:
Originally Posted by Daniel Fernandez View Post
I try to install it in my laptop but in the process it show me error, I used biolinux in my lab, it have installed by default.
Well with the *.p3out I extract the primers and other parameters with egrep command.
Thank you very much Piet.

If someone has the same problem
Hi Daniel, did you already solved the problem on:
"Primer modelling was successful for sequences.
Primer modelling failed for 11 sequences."

I have the same issue, just wanted to ask if you already found a workaround.

Thanks
cdseq is offline   Reply With Quote
Old 05-06-2016, 06:20 AM   #13
Daniel Fernandez
Member
 
Location: Lima. Perú

Join Date: Nov 2011
Posts: 31
Default

p3_out.pl never worked, I did manually with egrep, with this I can solve.
Daniel Fernandez is offline   Reply With Quote
Old 05-11-2016, 10:32 PM   #14
cdseq
Junior Member
 
Location: Los Banos

Join Date: May 2016
Posts: 3
Post

Hi Daniel, do yo know how to perform the same command (egrep) using command prompt in windows?
cdseq is offline   Reply With Quote
Old 05-13-2016, 08:33 AM   #15
Daniel Fernandez
Member
 
Location: Lima. Perú

Join Date: Nov 2011
Posts: 31
Default

Quote:
Originally Posted by cdseq View Post
Hi Daniel, do yo know how to perform the same command (egrep) using command prompt in windows?
Sorry I don't work on windows, but I search and I think is findstr, I never test this. look these links.

http://www.mkyong.com/linux/grep-for...ndstr-example/
http://stackoverflow.com/questions/8...ls-for-windows
http://stackoverflow.com/questions/1...rep-in-windows
http://superuser.com/questions/30081...-for-windows-7
Daniel Fernandez is offline   Reply With Quote
Old 08-21-2019, 06:38 AM   #16
titaji
Junior Member
 
Location: Bangkok, Thailand

Join Date: Aug 2019
Posts: 2
Default

Quote:
Originally Posted by GenoMax View Post
Start looking at FASTA.fa.p3out FASTA.fa.misa files to make sure that they are not empty or have some other issues in terms of format/content.
Hi GenoMax

I have the same problem as Daniel. But in my case, the *.p3in file is empty after I put this syntax

Code:
p3_in.pl FASTA.fa.misa
Could you tell me what might happen?

Thank you,
titaji
titaji is offline   Reply With Quote
Reply

Tags
microsatellite, misa, primer, primer3, primer3_core

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:51 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO