SEQanswers

Go Back   SEQanswers > Applications Forums > Genomic Resequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Looking process to convert gff3 format into ace format or sam format andylai Bioinformatics 1 05-17-2011 02:09 AM
Can novoalign use FASTA as a reference format? (Specifically for mapping paired-end) oiiio Bioinformatics 2 04-18-2011 09:47 AM
Bowtie MD tag format reference mendl7 Bioinformatics 2 02-23-2011 01:47 PM
SAMtool's pileup format - reference base question mfischer Bioinformatics 11 10-19-2010 04:12 PM
Question about using sra_toolkit to transform the SRA format into FASTQ format areyousad Bioinformatics 0 05-16-2010 10:56 PM

Reply
 
Thread Tools
Old 04-19-2011, 08:00 AM   #1
HSG_student1
Junior Member
 
Location: St. Louis

Join Date: Jun 2010
Posts: 1
Default Appropriate Reference Format

Hello,

I am trying to deal with some targeted resequencing data. I have a subset of hg19 that I targeted with a SureSelect Capture array and now have some Illumina HiSeq data on it. I aligned the reads to my .fasta formatted reference with Novoalign. The reference was downloaded from UCSC as exonic regions of known transcripts. An example is below. I am not aligning to all of h19 because I just want to see the alignments to the targeted regions. Do I need to align to the whole genome instead?

>hg19_ct_UserTrack_3545_hg19_knownGene_uc001cyp.2_8 range=chr1:57409309-57409587 5'pad=30 3'pad=30 strand=- repeatMasking=none
AACAGGGCTAGGCCTCTGGACTCGATCATAGGAAAAGGGACAGAGTGAAC
TACCTTTTACGTCATGGACCTTTTTCCTTGTTTTCTTCAGATTATACTCT
TAACAACGTCCATGCCTGTGCCAAAAATGATTTTAAAATTGGTGGTGCCA
TTGAAGAGGTCTACGTCAGTCTGGGTGTGTCTGTAGGCAAATGCAGAGGT
ATTCTGAATGAAATAAAAGGTGAGTGACAGGGGCTTGTGACTTCCACACT
TATAATGTTTATCCTCCTAGTGCCTCTGG
>hg19_ct_UserTrack_3545_hg19_knownGene_uc001aru.2_11 range=chr1:11086521-11087795 5'pad=30 3'pad=30 strand=- repeatMasking=none
TCAAATATATACTTCAAGGCGGTCATAATTTAAGAAAAACACGATTGACA
TTTTTACAAAGGCTCTCTACCTATCTGCTTCTTTCTCCAGTTTGTGGACT
ATCAGCCCGCACAACAGGAGGGCGTATATATGGAGGGCAAAAGGCAAAAC

The reads align fine using the above reference file in NovoAlign and I was able to make a .bam file with samtools and sort it in anticipation of making a bedGraph or Wiggle file using BEDTools. However, the headers used in my reference .fasta file do not seem to be compatible with the hg19.genome file that comes with BEDTools (a few lines are posted here):

chr1 249250621
chr2 243199373
chr3 198022430
chr4 191154276.

Any advice if I should redownload my targeted reference sequence in a different format? Or parse to contain some different header format, for example:
>chr1 start:xxxxxxx end:xxxxxx

I have found lots of great help for ways to manipulate the files, but can't seem to conquer this most basic step.

Thanks alot,
Mike
HSG_student1 is offline   Reply With Quote
Old 04-25-2011, 11:23 PM   #2
gaffa
Member
 
Location: Gothenburg/Uppsala, Sweden

Join Date: Oct 2010
Posts: 82
Default

I'm not an expert on exome sequencing but from what I gather you should probably always align reads to the whole genome, not only to the regions on your capture array. However this is for general conceptual reasons, I don't know what's going on with your particular files.

There has been some discussion of this on Biostar:
http://biostar.stackexchange.com/que...xome/7617#7617
http://biostar.stackexchange.com/questions/4413
gaffa is offline   Reply With Quote
Reply

Tags
fasta format, novoalign, reference

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:11 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO