SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
RTA v2.8 : Conflicts with low complexity sequence nickp Illumina/Solexa 2 06-04-2014 09:19 AM
programs for filtering low complexity swarbre Bioinformatics 5 02-05-2012 07:04 AM
Changing dNTP Flow Order for Low-Complexity Template Regions SeqNerd Ion Torrent 9 01-16-2012 06:28 AM
Sequencing low complexity libraries: effects on data casbon Illumina/Solexa 7 09-05-2011 11:51 PM
Help:primer and low complexity sequence filter alvin1982 Illumina/Solexa 0 04-21-2010 07:05 PM

Reply
 
Thread Tools
Old 11-30-2011, 02:01 PM   #1
ein_io
Member
 
Location: Bay Area

Join Date: Nov 2011
Posts: 14
Default PE sequencing of a lib with ONE end high and the other low complexity

I am preparing a custom library for paired end sequencing.

It is a low complexity lib. To circumvent the problem with cluster calling I have included NNNNN from the end that will be sequenced first (right after the ACACTCTTTCCCTACACGACGCTCTTCCGATCT which I assume is used for the first read)

I wonder whether I need to put NNNNN on the other side as well? Does the reverse read use the cluster positional information generated during the first read?

any thoughts - deeply appreciated

ein_io is offline   Reply With Quote
Old 11-30-2011, 02:59 PM   #2
HESmith
Senior Member
 
Location: Bethesda MD

Join Date: Oct 2009
Posts: 503
Default

Try searching the forum; this issue has been addressed multiple times.
HESmith is offline   Reply With Quote
Old 11-30-2011, 05:51 PM   #3
ein_io
Member
 
Location: Bay Area

Join Date: Nov 2011
Posts: 14
Default

tried searching the forum - found it mentioned once (in a thread discussing the bareback "delayed" cluster calling one guy says that clusters are not called during the reverse PE run) but not discussed explicitly

if you know the answer - can you tell me?
ein_io is offline   Reply With Quote
Old 12-01-2011, 03:52 AM   #4
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,315
Default

Quote:
Originally Posted by ein_io View Post
I am preparing a custom library for paired end sequencing.

It is a low complexity lib. To circumvent the problem with cluster calling I have included NNNNN from the end that will be sequenced first (right after the ACACTCTTTCCCTACACGACGCTCTTCCGATCT which I assume is used for the first read)

I wonder whether I need to put NNNNN on the other side as well? Does the reverse read use the cluster positional information generated during the first read?
Yes, the reverse read uses the cluster positions generated during the first read.

That said, I have noticed focus issues that seem to spring up when the instrument attempts a scan with no clusters fluorescing. (During the indexing cycles in my case.) My concern would be this would be especially an issue during the first few cycles of a read. Recent firmware upgrades have ameliorated this issue. But it still makes me nervous. But I think the instrument we have, the HiScanSQ, may be more susceptible to this issue than the more common HiSeqs.

Sacrificing those first 5 bases of your reverse read: I can't say it is worth it, but maybe.

--
Phillip
pmiguel is offline   Reply With Quote
Old 12-01-2011, 05:54 PM   #5
ein_io
Member
 
Location: Bay Area

Join Date: Nov 2011
Posts: 14
Default

Thank you very much, Phillip
ein_io is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:30 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO