SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
reads mapping to overlapping genes? beliefbio Bioinformatics 3 04-11-2014 12:18 AM
velvet assembly with non-unique reads: collapse or not? mgg Bioinformatics 0 02-24-2012 10:56 AM
Overlapping and non-Overlapping pair-end reads with Tophat senpeng Illumina/Solexa 4 10-16-2011 06:43 PM
non-overlapping reads in isotigs (screenshot) simoblimo 454 Pyrosequencing 2 01-30-2011 06:13 PM
How to manage overlapping paired-end reads? FredOnSeq Bioinformatics 2 09-09-2010 01:27 AM

Reply
 
Thread Tools
Old 09-19-2012, 08:12 AM   #1
mlafave
Junior Member
 
Location: Bethesda, MD

Join Date: Feb 2012
Posts: 5
Default Program to collapse overlapping PE reads?

Hi, all -

I'm looking for a program that will allow me to collapse paired-end FASTA reads into a single entry if the original reads overlap. For example, if I started with these reads:


>read/1
TCACAGCTGTATGCTAAACTAGATCTAGGTATGTGTGTGGGGTGGGGCTG
>read/2
CCACAATATGGGTGTAGACTTCAGCCCCACCCCACACACATACCTAGATC

...then I'd need it to produce a single entry, like this:
TCACAGCTGTATGCTAAACTAGATCTAGGTATGTGTGTGGGGTGGGGCTGAAGTCTACACCCATATTGTGG


Does anyone have any suggestions of a program that could do this? Thanks!
mlafave is offline   Reply With Quote
Old 09-19-2012, 09:48 AM   #2
JackieBadger
Senior Member
 
Location: Halifax, Nova Scotia

Join Date: Mar 2009
Posts: 381
Default

http://code.google.com/p/ea-utils/wiki/FastqJoin

Stitch https://github.com/audy/stitch fastq-join FLASH http://www.cbcb.umd.edu/software/flash/ mergePairs.py http://code.google.com/p/standardize.../mergePairs.py
JackieBadger is offline   Reply With Quote
Old 09-21-2012, 06:17 AM   #3
mlafave
Junior Member
 
Location: Bethesda, MD

Join Date: Feb 2012
Posts: 5
Default

Excellent, thanks!
mlafave is offline   Reply With Quote
Old 09-21-2012, 08:48 AM   #4
luc
Senior Member
 
Location: US

Join Date: Dec 2010
Posts: 415
Default

SeqPrep is another good one with many parameters in case someoptimization is needed. It also trims adapters:

https://github.com/jstjohn/SeqPrep
luc is offline   Reply With Quote
Old 09-21-2012, 10:40 AM   #5
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

Some of suggestions are in the master list of software: http://seqanswers.com/wiki/Software/list. Some are not.

People who suggest new programs (that are not on the master list) should take a moment to add them to the list.
GenoMax is offline   Reply With Quote
Old 02-10-2014, 06:45 AM   #6
SES
Senior Member
 
Location: Vancouver, BC

Join Date: Mar 2010
Posts: 275
Default

Just to be clear for anyone finding this post, all of the above programs I quoted from a previous answer, including SeqPrep, require Fastq input. None of them will work on Fasta data as the OP described, so I guess this is an open question.

Update: I have found that COPE works with Fasta data. There may be others, and I'll update this post if I find any that are useful.

Last edited by SES; 02-10-2014 at 07:30 AM.
SES is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:05 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO