SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bis-SNP: An accurate SNP and methylation calling tool for Bisulfite-Seq/NOMe-seq/RRBS DNAase Bioinformatics 10 04-30-2018 11:37 AM
GATK snp calling wanguan2000 Bioinformatics 0 11-24-2011 08:23 PM
SNP base calling shuang Bioinformatics 7 10-24-2011 11:50 AM
SNP calling elondin Bioinformatics 3 01-24-2011 09:59 AM

Reply
 
Thread Tools
Old 12-19-2012, 11:46 AM   #1
brachysclereid
Member
 
Location: California

Join Date: Feb 2011
Posts: 32
Default SNP calling

Reference-based SNP callers work by comparing the sequence aligned to the reference. Are there any tools/piplines that will call SNPs between aligned files? In my case I am interested in calling SNPs between the genotypes I am aligning and not in SNPs present between by genotypes and the reference.
brachysclereid is offline   Reply With Quote
Old 12-19-2012, 02:02 PM   #2
brachysclereid
Member
 
Location: California

Join Date: Feb 2011
Posts: 32
Default SNP calling between samples....in a polyploid

I should also add that I am trying to call SNPs either without a reference genome or with the diploid version of a polyploid I am working with.
brachysclereid is offline   Reply With Quote
Old 12-19-2012, 02:05 PM   #3
rfilbert
Member
 
Location: San Diego, CA

Join Date: Dec 2012
Posts: 43
Default

Partek Flow calls SNPs either against a reference or between your samples.
rfilbert is offline   Reply With Quote
Old 12-19-2012, 02:12 PM   #4
brachysclereid
Member
 
Location: California

Join Date: Feb 2011
Posts: 32
Default

Surely there is something free from academic labs that will do this
brachysclereid is offline   Reply With Quote
Old 12-19-2012, 02:22 PM   #5
rfilbert
Member
 
Location: San Diego, CA

Join Date: Dec 2012
Posts: 43
Default

If it makes you feel better, Partek's SNP caller is also about 50x faster than mpileup which is one of the main reasons I went with them. I have not compared it to GATK yet. While it is commercial, it is not expensive and comes with technical support.
rfilbert is offline   Reply With Quote
Old 12-19-2012, 02:25 PM   #6
brachysclereid
Member
 
Location: California

Join Date: Feb 2011
Posts: 32
Default

Is there a way to call SNPs between samples with samtools mpileup or GATK?
brachysclereid is offline   Reply With Quote
Old 12-19-2012, 03:49 PM   #7
Zam
Member
 
Location: Oxford

Join Date: Apr 2010
Posts: 51
Default

Cortex is designed to call variants between samples, without a reference.

Papers:
1. De novo assembly and genotyping of variants using colored de Bruijn graphs.
Z Iqbal, M Caccamo, I Turner, P Flicek, G McVean, Nature Genetics (2012)

2. High-throughput microbial population genomics using the Cortex variation assembler. Z Iqbal, I Turner, G McVean, Bioinformatics 2012

Software freely available here:
http://cortexassembler.sourceforge.n...ortex_var.html

Manual here
http://cortexassembler.sourceforge.n...ser_manual.pdf

It can take BAM or fast files as input. Hope that helps!

Zam
Zam is offline   Reply With Quote
Old 12-28-2012, 03:14 PM   #8
brachysclereid
Member
 
Location: California

Join Date: Feb 2011
Posts: 32
Default SNP calling between samples....in a polyploid

Thanks for all the suggestions. I will check out Cortex. Do you think it can handle polyploids?
brachysclereid is offline   Reply With Quote
Old 12-29-2012, 05:28 AM   #9
Zam
Member
 
Location: Oxford

Join Date: Apr 2010
Posts: 51
Default

Yes, it can call biallelic sites in polyploids. The genotyping models only handle haploid and diploid, so you will have to do discovery only, but the VCF will report coverage on both alleles, so you can post-process to interpret.
Zam is offline   Reply With Quote
Old 05-08-2013, 02:34 AM   #10
rob123king
Junior Member
 
Location: cranfield

Join Date: Feb 2013
Posts: 9
Default

Anyone know how I can do snp calling using a draft reference which is a series of contigs, example head below. I can do it using BWA-MEM and mpileup with a complete reference but using this draft I get almost no data. I think theres an issue with alingment to the draft reference as it is not a series of continuous data, maybe if i use some program to put them all together and fill in the gaps with N's or do the contigs just need renaming? Little lost how could use this draft genome, may just end up comparing against a more distant but complete genome.

>contig:unspecified:411:1:710:1 contig 411
GTTAGTGCCTACTGCCTCTTTTTCATCTGCCTGAATATCTCTCATCTTTCGTTATCCTTA
ATTGTCCTCATATCTTTCGATTATTTGTCAGGTTTTTGAGTATTAGGTGCTTATTCTTTA
AAAAATACACAGAAAGTTTATCGAAATGCTGCATTTAATCGTATTGTATATGAATACGCA
TTCTCTAACTGGTAAATGTATTGTACGAAAGAATTGTGTCTCAATGAAGTAAGTGGTTAT
CTCTGGTGTTAAGTTGGTGAGTATTTGTTGAATATTGATATTAATACCAGCAAATTGGAA
GTGATATTGAGTAAATGTTGGGATAGTAGTAAAGAGAAAGAACTTCGGTGTATAAGCGAA
AACTTCATTTAACCGTTAACAATACGATGGAAATAAGCACATGAAAATAATCTCATTTCC
TAGAATAGAGTCAGATTACTTGCTATTCTTAATTGTTGTTTCAAATGAAGTAGTACTAAC
TACTAACTACAGTAGAAATTGCAATATAATTTCCACTCTCCCTTGTGGAATTGGTAATTT
TGTGAGGGTAATATTAATATGCTTTGCTGCTCCTTAATAAAAATCAAACCATCAACTCTA
CCAAAATTAGTTGGGGTCAGTGATAGGAATTAATATTAGGTTATTTTTTGAAAACATAAT
GTATACACGGAAAGTGAGGAGAAAAAGGACAGGGGAATACAATATGGGAA
>contig:unspecified:586:1:3978:1 contig 586
TATATTTGCCTCATAAGAATGGGCCTATGGGCAAAAATGGGTTGGTCCAGATTGGGCTTT
TATTTATTTACATAGGAAGGGAAAAAGGCCCATAACCCAACAATTTTAACACCACATTCA
TTTACAAATCTACCCATTTGACCGAATCGACTTTTTTTCTTTTCATGTTCTTCTTCTCTC
AAGATAATTTAATTTATGATATTATCACAGTAAAATAAAAATTACTAAAATCTCACGCCG
TTTGCCCATTTTACAAACAAATTATATATCTTGTTGATTTAAATAAAAAAGAGATATATT
TAGATTAATAAATATAAAAGATAACGTAAATTTGTGTCATTTTATAATGAAAGGGGCATA
TATGAATTCAAAATATATTGAAAGGAATGTATTTAGATAAAAAAATATAGCGAAGGGTAT
rob123king is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:50 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO