SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
primer3 krunal Bioinformatics 3 05-26-2014 04:08 AM
Design of barcoding primers for ion torrent NGS of a CRISPR genome wide screen pierre sujobert Sample Prep / Library Generation 0 05-10-2014 05:18 AM

Reply
 
Thread Tools
Old 04-30-2015, 04:55 PM   #1
arkilis
Senior Member
 
Location: Australia

Join Date: Jul 2013
Posts: 119
Default using primer3+ design primers received a warning?

When I use primer3+ to do the primer design. It gives out a warning:

Checking for poly-A and poly-T regions >= 7 bp, and potential hairpins ( >= 85% GC in a 30 bp window):

Amplimer 1: Poly-A region in amplimer TTGGAGGAAGATGCTTAGCC[...]GGTTAATGAAGTGTGGAGACTCC

What does this mean? Thanks
arkilis is offline   Reply With Quote
Reply

Tags
primer, primer desgin, primer3

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:08 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO