SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Genomatix RNA-Seq workflow rebrendi Bioinformatics 1 02-13-2012 07:13 AM
Extracting reads from barcoded pooled samples megh Bioinformatics 1 06-27-2011 11:42 PM
RNA-seq workflow foxyg Bioinformatics 1 11-11-2010 03:26 PM
Custom barcoded RNA-seq nasobema Illumina/Solexa 4 08-04-2010 07:46 PM
Barcoded PE adapters for multiplexing up to 12 samples Pepe Illumina/Solexa 9 01-28-2010 04:36 PM

Reply
 
Thread Tools
Old 04-19-2011, 12:58 PM   #1
jjw14
Member
 
Location: Missouri

Join Date: Apr 2010
Posts: 39
Question RNA-seq Galaxy workflow for PE barcoded samples?

Hello,

I am working with RNA-seq Illumina data files in Galaxy (http://main.g2.bx.psu.edu/). The files are 100bp paired-end reads, multiplexed with barcoding to distinguish samples. There are two files, one for each end of the paired-end reads (first three reads of the files are pasted below). The barcodes are the first four bases of the sequences in the s_7_1_sequence.txt file.

Would the following Galaxy workflow be correct?

1. Upload both s_7_1_sequence.txt and s_7_2_sequence.txt to Galaxy with the reference genome selected
2. Run NGS: QC and manipulation --> FASTQ Groomer on each file to convert to Sanger FASTQ
3. Run NGS: QC and manipulation --> FASTQ joiner to combine the data from the two files
4. Run FASTX-TOOLKIT FOR FASTQ DATA --> Barcode Splitter to generate separate FASTQ files for each barcode group
5. Run NGS: RNA Analysis --> Tophat to map the reads from each group to the reference genome

The problem I am having is that if I select paired-end for the library in Tophat, it requests two FASTQ files. Would I have to use FASTQ Splitter to separate the joined FASTQ files? I would be very appreciative of any suggestions.

Thanks very much in advance,
jjw

File 1: s_7_1_sequence.txt

@HWI-ST538_0096:7:1:1443:1917#0/1
CGTTNCAGACTCTGCAACGACAGCCTGCCCCCCGGCACCGTGAAGCTCTAGGCACGGCCTGCTCGCCGCCCGGGGACAAGGACTCCTGCCGCTGCCCCCG
+HWI-ST538_0096:7:1:1443:1917#0/1
aaa`BcccccggggggfgggfgagggggdaggggggcegedeaadaggdegeeggdebgdZccc]Z`Z^c`S__[^_`aO_Zc^cd`Y`dBBBBBBBBBB
@HWI-ST538_0096:7:1:1468:1938#0/1
ACGTNGTCTGTGATGCCCTTAGATGTCCGGGGCTGCACGCGCGCTACACTGACTGGCTCAGCGTGTGCCTACCCTACGCCGGCAGGGGCGGGGAACCCCC
+HWI-ST538_0096:7:1:1468:1938#0/1
`_`^Bb_babegggggggggceeeedeggddeggeggegeeedeeeeegddeddccVacVX\ZSXXSX_Xb_XbBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWI-ST538_0096:7:1:1484:1983#0/1
AAAGTAGCAAATACACAGCATGAGAAATCGGCATCGGATGTCACAGGGAAAGTAGCAAACACACAGCATGAGAAATCAGCATCGGTTGTCACAGAGAAAG
+HWI-ST538_0096:7:1:1484:1983#0/1
gggggfggegfggeggfgggggegggggeggefggggegg\dd^dadc]dda\dcddecZb[b`e_^]_\bbbee`TdY^_Y^BBBBBBBBBBBBBBBBB

File 2: s_7_2_sequence.txt

@HWI-ST538_0096:7:1:1443:1917#0/2
CGTTGGCAGCAGGCAGAGGTGGTGCAGTGGCAGCGGCAGGGGGCCTTGTCCCCGGGCGGCGGGCAGGCGCGGCCCCAGGCGTTACGGGGGCCGGGGGGGG
+HWI-ST538_0096:7:1:1443:1917#0/2
ggggggggggggdgegcgaahebfefebbeecfabcaX`cBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
@HWI-ST538_0096:7:1:1468:1938#0/2
ACGTTGGGAATTCCTCGTTCATGGGGAATAATTGCAATCCCCGATCCCCATCACGAATGGGGTTCAACGGGTTACCCGCGCCTGCCGGCGTAGGGTAGGA
+HWI-ST538_0096:7:1:1468:1938#0/2
gggggggggggggggggggdgggggeedegggadbffedb[dedddcecdgaehefegfdeebcdfadecacafPbb`Lbbd_ZdUX^BBBBBBBBBBBB
@HWI-ST538_0096:7:1:1484:1983#0/2
TTTCCCCATGACATCCGATGCTGATTTCTCATGCTGTGCGTTTGCTACTTTCTCTGTGACAACCGATGCTGATTTCTCATGCTGTGTGTTTGCTACTTTC
+HWI-ST538_0096:7:1:1484:1983#0/2
gggggggggggggggggggggggbgggedggggggeagefegbgdgaeeggggfgcgfegagggggegg`aad_fee_bgdddd^cX`caQX[M[bce`c
jjw14 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:26 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO