SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Threshold quality score to determine the quality read of ILLUMINA reads problem edge Illumina/Solexa 35 11-02-2015 10:31 AM
Quality Score: FastQC vs Illumina ericguo Illumina/Solexa 8 10-22-2015 04:08 AM
Questions on the updated illumina quality score zeam Bioinformatics 6 10-26-2011 11:08 AM
Illumina quality score whereisshe Bioinformatics 3 11-26-2010 06:45 AM
Threshold quality score to determine the quality read of ILLUMINA reads problem edge General 1 09-13-2010 02:22 PM

Reply
 
Thread Tools
Old 08-03-2011, 04:39 PM   #1
gridbird
Member
 
Location: san diego

Join Date: Oct 2010
Posts: 16
Default about illumina reads quality score

I got sequencing reads like this:

@HWI-ST644:6806CMACXX:3:1101:2217:2245 1:N:0:CGATGT
TATTATGGGCGCACTGAAGGTGTAGAAACTGCCGTCCTCCGTGATGACGGACATATTCGTTTCGTTGGGAAAATTCCTTACGGTAGCCTTCACACGGATG
+
CCCFFFFFHFHHHJJJIJJJFGHGHIIJJJJJJJHIIJJJJIJJFIJJJIIJHHHHHFFFFFCDDEDDDDDDDDDDDDDDDDDCBDDDDDDDCCDDDDDB

but I am wondering which version of Illumina GA pipeline used. I just want to get the quality score of each base, but I don't know how to caculate it. I just found the information from wiki:

NCBI/Sanger or Illumina 1.8 and later. Using a Phred scale encoded using ASCII 33 to 93.
Illumina Pipeline 1.2 and earlier. Using a Solexa/Illumina scale (-5 to 40) using ASCII 59 to 104. T
Illumina Pipeline 1.3 and 1.4. Using a Phred scale using ASCII 64 to 104.
Illumina Pipeline 1.5 to 1.7. Using a Phred scale using ASCII 64 to 104.
gridbird is offline   Reply With Quote
Old 08-03-2011, 04:47 PM   #2
chadn737
Senior Member
 
Location: US

Join Date: Jan 2009
Posts: 392
Default

This looks like v1.8 so the quality scores should be ASCII 33
chadn737 is offline   Reply With Quote
Old 08-04-2011, 08:13 AM   #3
HESmith
Senior Member
 
Location: Bethesda MD

Join Date: Oct 2009
Posts: 505
Default

The scores indicate v1.8. Your highest score is 'J', which is ASCII 74. With offset +33, that's 41, which is currently Illumina's top quality score.

Another way to check is to look for reads with Illumina's low quality flag (2); # for v1.8, B for earlier versions.
HESmith is offline   Reply With Quote
Old 08-04-2011, 09:05 AM   #4
gridbird
Member
 
Location: san diego

Join Date: Oct 2010
Posts: 16
Default

Thanks for help!!
gridbird is offline   Reply With Quote
Old 08-08-2011, 05:10 AM   #5
dongzw
Junior Member
 
Location: Shanghai

Join Date: Aug 2011
Posts: 8
Default

Thank you all for sharing the information!
dongzw is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:07 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO