SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Bowtie beginner question... milesgr General 6 03-14-2012 06:21 AM
Beginner Sequencing Analysis question mgibson General 0 06-17-2011 09:30 AM
What exactly is AddOrReplaceReadGroups (picard tools) doing? ocs Bioinformatics 6 06-09-2011 07:51 AM
1000 genomes - a beginner question EHC Bioinformatics 3 05-26-2011 12:51 AM
Picard AddOrReplaceReadGroups Error ercfrtz Bioinformatics 1 03-28-2011 05:21 AM

Reply
 
Thread Tools
Old 09-02-2012, 06:40 AM   #1
yeppomonkey
Junior Member
 
Location: St. Louis, MO

Join Date: Aug 2012
Posts: 3
Default Beginner question about Picard AddOrReplaceReadGroups

Hi,
I am just starting to learn how to use novocraft and GATK, and I reached a point during my analysis where GATK said my file was not accepted without read groups. I searched the forum and people have suggested to use AddOrReplaceReadGroups from picard. I was looking at the picard source page and I am not sure of some the required options. I am trying to understand as much I can about what I am putting through the various software. But I don't understand some of the options.
Can some one help explain what the RGPU options is ( Read Group platform unit (eg. run barcode) Required). Would I get this RGPU from the raw data? or is this something that comes with the documentation for the sequencer?
The exome I am analyzing was sequenced by illumina.
Any help would be very appreciated. Thanks
Not sure if this is useful, but here is the first few lines of my data before alignment:
Quote:
@HWI-ST132_0459:8:1101:1113:1946#GGCTAC/1
ATTAGAAAAGTAGATTCACATGGTTTTCCACATGTTAGAGGAATTGATAGAATTCTATTTGAACAAAGGACAGTGTTTAC
AAATAATAGCAATGCCATAT
+HWI-ST132_0459:8:1101:1113:1946#GGCTAC/1
ffffffafd^deeeeaaT`adddddac\Vceeeeefff`fbeee`]KK][c_bc^dad_d]`ddZLKYYUcccY^c_ac_
b]WabY_]__NZ[[ZcccUc
@HWI-ST132_0459:8:1101:1247:1955#GGCTAC/1
TAAATAATTTAAATTTCTGATCATAGCCTATTTTTGATATCACAAGGATGACGTCTTGATCTGATAGGAAGGATAAGATA
ACAAGAGGGCCTAGACTAGT
+HWI-ST132_0459:8:1101:1247:1955#GGCTAC/1
gfgfggggggggggggggggggggfggggdgfegggefggggfgegeegegggcggggcgggecggg\eeeecdeegfee
ggeggaaad^e^_acdaYd^
@HWI-ST132_0459:8:1101:1059:1956#GGCTAC/1
AGTAATGACTTAAATAGACATTCTAATGTGGTGCAAAGCTCACGACTCAATATTGAGTACAAAAAAAAAGCAAGTTGTAT
GTGTTAGCCCATTCTCACAC
+HWI-ST132_0459:8:1101:1059:1956#GGCTAC/1
gggfggfgggggggggg_gegagdggegeeeegggadefeggegdedggaeaeecddZeeebdccgegg_edTb[eeaee
eeeeedebeeeYbcbf]ccf
@HWI-ST132_0459:8:1101:1227:1985#GGCTAC/1
TGAATGACTTTGAGATATGGTGTTGGCACTGAATTAAGACAGGAGAAGACTACTGGTGATCTAAAAGGAAATAGTGTTAT
AGTAGTAAAGAAGGAATCCA
+HWI-ST132_0459:8:1101:1227:1985#GGCTAC/1
ggggggggggggegggegggegegggggffggfgfgggggggfdgaegdggfgggecggeeeg_edfecedaedbfff`f
egggfeaefeggffcgdgfc
@HWI-ST132_0459:8:1101:1070:1988#GGCTAC/1
cmyers@cgscluster:~/musa/Eurodata$ clear
cmyers@cgscluster:~/musa/Eurodata$ more pt170.fq
@HWI-ST132_0459:8:1101:1113:1946#GGCTAC/1
ATTAGAAAAGTAGATTCACATGGTTTTCCACATGTTAGAGGAATTGATAGAATTCTATTTGAACAAAGGACAGTGTTTAC
AAATAATAGCAATGCCATAT
+HWI-ST132_0459:8:1101:1113:1946#GGCTAC/1
ffffffafd^deeeeaaT`adddddac\Vceeeeefff`fbeee`]KK][c_bc^dad_d]`ddZLKYYUcccY^c_ac_
b]WabY_]__NZ[[ZcccUc
@HWI-ST132_0459:8:1101:1247:1955#GGCTAC/1
TAAATAATTTAAATTTCTGATCATAGCCTATTTTTGATATCACAAGGATGACGTCTTGATCTGATAGGAAGGATAAGATA
ACAAGAGGGCCTAGACTAGT
+HWI-ST132_0459:8:1101:1247:1955#GGCTAC/1
gfgfggggggggggggggggggggfggggdgfegggefggggfgegeegegggcggggcgggecggg\eeeecdeegfee
ggeggaaad^e^_acdaYd^
@HWI-ST132_0459:8:1101:1059:1956#GGCTAC/1
AGTAATGACTTAAATAGACATTCTAATGTGGTGCAAAGCTCACGACTCAATATTGAGTACAAAAAAAAAGCAAGTTGTAT
GTGTTAGCCCATTCTCACAC
+HWI-ST132_0459:8:1101:1059:1956#GGCTAC/1
gggfggfgggggggggg_gegagdggegeeeegggadefeggegdedggaeaeecddZeeebdccgegg_edTb[eeaee
eeeeedebeeeYbcbf]ccf
@HWI-ST132_0459:8:1101:1227:1985#GGCTAC/1
TGAATGACTTTGAGATATGGTGTTGGCACTGAATTAAGACAGGAGAAGACTACTGGTGATCTAAAAGGAAATAGTGTTAT
AGTAGTAAAGAAGGAATCCA
yeppomonkey is offline   Reply With Quote
Old 09-03-2012, 10:59 PM   #2
TiborNagy
Senior Member
 
Location: Budapest

Join Date: Mar 2010
Posts: 329
Default

The read group can be found in your sam/bam file. This file is generated by a mapping program (in your case it is novoalign). If you have multiplexed data, then you need to separate the results in your sam/bam file with read group. However if you do not have multiplexed data, does not matter what kind of strings do you add to AddOrReplaceReadGroups.
TiborNagy is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:12 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO