SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
problem with bowtie input file StephaniePi83 Bioinformatics 0 10-23-2011 11:50 PM
Correct input file format for SLOPE? Heisman Bioinformatics 2 09-21-2011 06:20 AM
Size limit for the BAM input of Artemis nivea General 0 04-12-2011 07:38 AM
csfasta files - miRanalyzer input file format naluru SOLiD 0 12-09-2010 08:55 AM
BWA input file in sanger format doubts.. seq_GA Bioinformatics 1 06-08-2010 01:24 AM

Reply
 
Thread Tools
Old 10-28-2010, 06:17 AM   #1
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default Artemis acceptable input file format problem

Hi,

I'm the new user of Artemis. I plan to use Artemis to view my gene prediction from GeneMark and Glimmer's result of my fungus genome.
Unfortunately, I'm facing a problem when I upload to view the gene prediction result of GeneMark and Glimmer at the same time.
Due to the overlap gene prediction between two different gene prediction program (GeneMark and Glimmer ), I unable to differentiate whether the viewer shown the result of GeneMark or Glimmer.
I'm plan to add the "Colour" label column in my GeneMark and Glimmer result file.
Unfortunately, after I added the "Colour" column, Artemis can't view the result properly

Below is the input file format that I have used to view the result in Artemis:
Code:
FT   gene         complement(1687575..1689053)
FT                   /note="NODE_120.1.len:75266-31, orf00001, 1515..37"
FT                   /label=orf00001
FT   gene         complement(1689257..1689964)
FT                   /note="NODE_120.1.len:75266-31, orf00004, 2426..1719"
FT                   /label=orf00004
FT   gene         complement(1689915..1690289)
FT                   /note="NODE_120.1.len:75266-31, orf00005, 2751..2377"
FT                   /label=orf00005
Fail to view the result in Artemis after I added the detaill of "Colour" column

Code:
FT   gene         complement(1687575..1689053)
FT                   /note="NODE_120.1.len:75266-31, orf00001, 1515..37"
FT                   /label=orf00001
FT                   /colour=7
FT   gene         complement(1689257..1689964)
FT                   /note="NODE_120.1.len:75266-31, orf00004, 2426..1719"
FT                   /label=orf00004
FT                   /colour=7
FT   gene         complement(1689915..1690289)
FT                   /note="NODE_120.1.len:75266-31, orf00005, 2751..2377"
FT                   /label=orf00005
FT                   /colour=7
Thanks for any experience user of Artemis to share your opinion to solve my problem.
edge is offline   Reply With Quote
Old 10-28-2010, 08:08 AM   #2
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Have you tried color (although I think Artemis takes both colour and color) and quotes round the number?

Also you indentation looks funny to me.
maubp is offline   Reply With Quote
Old 11-16-2010, 01:18 AM   #3
Hobbe
Member
 
Location: Uppsala, Sweden

Join Date: Apr 2010
Posts: 29
Default

Try saving (in Artemis) your gene prediction results in another format such as EMBL or Genbank. I use EMBL. In this format you should be able to add the color information you need.
Hobbe is offline   Reply With Quote
Old 11-16-2010, 07:59 AM   #4
hanifk
Member
 
Location: China

Join Date: Oct 2010
Posts: 18
Default

the \colour is ok for me.
can you tell us what the error artemis reported?

maybe your problem is about the number of space.
in my experience, there are 5 spaces before "gene",and 12 spaces between
"gene"and "complement",the \colour can't be placed before "complement" in the next line.

good luck.
hanifk is offline   Reply With Quote
Old 11-17-2010, 06:35 PM   #5
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

Hi hanifk,

Thanks a lot for your reply and advice.
Can you show me one of the example that you have tried before to show the \colour?
Based on the example that I shown previously, only some of the data will show "colour" but some will still remain "colourless" when open with Artemis program
I think might be the format that I shown previously is not accept by Artemis program.

Quote:
Originally Posted by hanifk View Post
the \colour is ok for me.
can you tell us what the error artemis reported?

maybe your problem is about the number of space.
in my experience, there are 5 spaces before "gene",and 12 spaces between
"gene"and "complement",the \colour can't be placed before "complement" in the next line.

good luck.
edge is offline   Reply With Quote
Old 11-17-2010, 06:37 PM   #6
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

Hi Hobbe,

The gene prediction result from Genemark and Glimmer only allow me to save the output result in gff format.
After then, I will write a script to convert the gff format into Artemis acceptable input file format. (as I shown in above)
Do you mind to show your example that how you shown the color effect in Artemis program?
Thanks first
edge is offline   Reply With Quote
Old 11-17-2010, 08:25 PM   #7
hanifk
Member
 
Location: China

Join Date: Oct 2010
Posts: 18
Default

Quote:
Originally Posted by edge View Post
Hi hanifk,

Thanks a lot for your reply and advice.
Can you show me one of the example that you have tried before to show the \colour?
Based on the example that I shown previously, only some of the data will show "colour" but some will still remain "colourless" when open with Artemis program
I think might be the format that I shown previously is not accept by Artemis program.
I think,Artemis will stop to read when counter invalidate items.
So,It will only display partly if there are invalidate items.

In my file,
Code:
     gene            365..1696
     gene            1934..3046
     gene            3060..3266
     gene            complement(4927..4199)
     gene            complement(5276..5924)
ORIGIN
TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

Code:
     gene            365..1696
                     /colour=5
     gene            1934..3046
                     /colour=6
     gene            3060..3266
                     /colour=7
     gene            complement(4927..4199)
                     /colour=8
     gene            complement(5276..5924)
                     /colour=9
ORIGIN
TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC
Attached Images
File Type: jpg 5.jpg (62.7 KB, 12 views)

Last edited by hanifk; 11-17-2010 at 08:28 PM.
hanifk is offline   Reply With Quote
Old 11-17-2010, 08:49 PM   #8
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

Thanks hanifk.
Do you have add "FT" in all of your first column?

Quote:
Originally Posted by hanifk View Post
I think,Artemis will stop to read when counter invalidate items.
So,It will only display partly if there are invalidate items.

In my file,
Code:
     gene            365..1696
     gene            1934..3046
     gene            3060..3266
     gene            complement(4927..4199)
     gene            complement(5276..5924)
ORIGIN
TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC

Code:
     gene            365..1696
                     /colour=5
     gene            1934..3046
                     /colour=6
     gene            3060..3266
                     /colour=7
     gene            complement(4927..4199)
                     /colour=8
     gene            complement(5276..5924)
                     /colour=9
ORIGIN
TTTTTCTTATTGATAATCTGTTGATAATTTGCTATTATAGAAGTAAACCTGTTGATAACTTAAATAAATT
GTAGCCACAAATATAACAACTTATTCACAGGTTGTTGATAAGTTTGTGGATAAGTTGTTATTTCAGTGTT
AATGGACCTATTTTATTTTTAAAAAACGGCGATAGGTCAATTTTTTTGTCGCATTTTTTATATACAGCTA
TTTTATCAACAGGACCTTGAAAACTGTTTTTTCAAAAAGCGATTTCAACAAAATTAAAAATTACTTATCC
edge is offline   Reply With Quote
Old 11-17-2010, 09:32 PM   #9
hanifk
Member
 
Location: China

Join Date: Oct 2010
Posts: 18
Default

Quote:
Originally Posted by edge View Post
Thanks hanifk.
Do you have add "FT" in all of your first column?
No, I wrote script to generate the .gbk file
I didn't know what FT means,so I didn't contain it.
hanifk is offline   Reply With Quote
Old 11-17-2010, 11:58 PM   #10
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

Hi Hanifk,
Thanks a lot for your example.
It is working in my place now
Besides that, do you have any experience to show the two or more different gene prediction result (eg. genemark, glimmer, augustus, etc) in Artemis at the same times in order to know the difference gene prediction result by different gene prediction program?
edge is offline   Reply With Quote
Old 11-18-2010, 12:50 AM   #11
maubp
Peter (Biopython etc)
 
Location: Dundee, Scotland, UK

Join Date: Jul 2009
Posts: 1,543
Default

Quote:
Originally Posted by hanifk View Post
No, I wrote script to generate the .gbk file
I didn't know what FT means,so I didn't contain it.
In an EMBL feature table, the lines start with FT, but in a GenBank feature table they don't. Artemis can read both EMBL and GenBank files.
maubp is offline   Reply With Quote
Old 11-18-2010, 04:54 AM   #12
edge
Senior Member
 
Location: China

Join Date: Sep 2009
Posts: 199
Default

thanks a lot for your sharing, maubp
edge is offline   Reply With Quote
Old 07-19-2012, 02:06 PM   #13
bspdlp
Junior Member
 
Location: uk

Join Date: Jul 2012
Posts: 1
Default

Quote:
Originally Posted by hanifk View Post
I think,Artemis will stop to read when counter invalidate items.
So,It will only display partly if there are invalidate items.
Indeed, this is why your EMBL code is rejected. the "location/qualifier" needs to start at character position 22. In your example at the top the FT...\colour line is correct but the other lines for each gene are missing a couple of space characters.
In gbk format, you would be missing the first 4 characters starting at the "key" and the qualifier would start at position 18.

Hope this helps someone as this is not written enough in the manuals.
bspdlp is offline   Reply With Quote
Old 07-19-2012, 03:58 PM   #14
Lsterck
Junior Member
 
Location: Ghent, Belgium

Join Date: Feb 2011
Posts: 2
Default

Quote:
Originally Posted by edge View Post
Hi Hanifk,
Thanks a lot for your example.
It is working in my place now
Besides that, do you have any experience to show the two or more different gene prediction result (eg. genemark, glimmer, augustus, etc) in Artemis at the same times in order to know the difference gene prediction result by different gene prediction program?
On the left side of your artemis window at the top of each pane you should have some small buttons with '>>' or '<<' on it. These are used to show/hide the different panes you have in the artemis window. By default the top pane is hidden, click on the '>>' underneath the 'Entry:' line, to show it. In that pane the annotations tracks are shown one under the other to make it easy to compare them.
I hope it's somewhat what you are looking for.

Last edited by Lsterck; 07-20-2012 at 05:21 AM.
Lsterck is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:37 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO