SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Error in bowtie's sam output? burt Bioinformatics 11 11-25-2012 03:53 PM
BWA:getting hits with given number of mismatches and indels Chandana Bioinformatics 0 01-11-2012 10:03 AM
Number of mismatches in Bowtie Rachelly Bioinformatics 0 05-08-2011 12:55 AM
sam to Bowtie output seq_GA Bioinformatics 0 03-21-2011 10:56 PM
Bowtie and SAM output rdeborja Bioinformatics 0 12-03-2009 10:30 AM

Reply
 
Thread Tools
Old 01-07-2011, 02:15 PM   #1
sridharacharya
Member
 
Location: Institute, WV

Join Date: May 2010
Posts: 24
Post bowtie sam output, number of mismatches

Hi,

If I am right, bowtie options -n 0 -l 16 should not allow any mismatches in the seed region of 16. But the following result is puzzling me.

I am aligning sequencing reads using the above options to miRNA sequences.
In SAM format output, I can find some lines with mismatches right in the beginning. Why is this?

I suppose the field containing "MD:" denotes the positions of mismatches. For the first record, there is a mismatch in the first position and for the second one, there is mismatch on the 26th position. For the above options, bowtie should not report mismatches in the seed region, then why is this happenning. Or Am I reading it wrongly?

2_1977_1917_F3 16 106b 23 255 48M * 0 0 GCGTTTCCGGACTACATCGGCGAACCTGATCTGCACTGTCAGCACTTT qqqqqqqqqqqq!!qqqqqqqqq!!qqqqqq!!qqqqqqqqqqqqqqq XA:i:0 MD:Z:0A1A0G1G1G1T1G0C2G0G0A1A0G2C1A0C0T20 NM:i:17 CM:i:27
2_1977_1040_F3 0 7-3 32 255 48M * 0 0 GGAAGACTAGTGATTTTGTTGTTCTAAGGTTTTACGACTACAATTCCC qqqqqqqqqqqqqqqqqqqqqqq!!qqqqqqqqqq!!qqq!!qqqqqq XA:i:0 MD:Z:25G1T2A0C6A4G2A1 NM:i:7 CM:i:16
sridharacharya is offline   Reply With Quote
Old 01-08-2011, 05:17 PM   #2
frozenlyse
Senior Member
 
Location: Australia

Join Date: Sep 2008
Posts: 136
Default

The flag of the first read (field 2) is 16 (0x10) which means that the read mapped to the reverse strand - the SAM format specifies that all alignments are to be represented on the forward strand, so the read is reported as the reverse complement, so the mismatches you are seeing are actually at the 3' end of the read
frozenlyse is offline   Reply With Quote
Old 01-08-2011, 05:22 PM   #3
sridharacharya
Member
 
Location: Institute, WV

Join Date: May 2010
Posts: 24
Default

Thanks frozenlyse. Clears my doubt!
sridharacharya is offline   Reply With Quote
Reply

Tags
bowtie mismatches sam

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:01 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO