SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Low miRNA count - small RNA NGS kanrcc Introductions 5 06-30-2014 11:15 PM
find areas of very low and extra high coverage in NGS data willMD Bioinformatics 4 04-04-2013 10:33 AM
extra high coverage regions in exome sequencing data lyz1030 Bioinformatics 1 10-22-2012 02:26 AM
keeping RNA-Seq reads mapping to repeats within genes Rachel Hillmer Bioinformatics 0 06-27-2012 07:21 AM
small rna seq with total lane read count different between conditions anle Bioinformatics 0 01-25-2012 01:25 PM

Reply
 
Thread Tools
Old 04-02-2015, 09:51 AM   #1
samhokin
Member
 
Location: Santa Fe, NM

Join Date: Nov 2013
Posts: 20
Default Extra high-count repeats in small RNA reads

I'm new to small RNA sequencing, and a bit confused about some of the sequences I'm seeing and wonder if you can provide some tips. I'm looking at a public dataset (SRP032955) in which the reads have already been de-multiplexed (if they were barcoded in the first place) to single-sample files. After I trim off the Illumina 3' adapter, I still have a number of sequences that are very highly repeated, but which I can't identify as sequencing artifacts. Here's a good example:

>raw read (3' adapter in red)
TCTATGTTCAGTGCGACTGCATGGAATTCTCGGGTGCCAAGGAACTCCAG
>resulting trimmed read
TCTATGTTCAGTGCGACTGCA

This trimmed read appears 23584 times, or 1.3% of the reads. FastQC labels it as "No Hit" in the Overrepresented sequences list, along with a whole bunch of other "No Hit" highly-repeated sequences.

Is this a real *RNA or an artifact? It doesn't BLAST to the Maize B73 genome, although this sample is Maize W23, for which I don't have a genome sequence handy.
__________________
Sam Hokin
Computational Scientist, Carnegie and NCGR
samhokin is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:01 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO