(cross posted on biostar: http://biostar.stackexchange.com/questions/9961 )
Hi all,
I know, by capillary sequencing, that one of my samples contains a mutation at position:120458492.
Some reads were aligned with bwa and I can clearly see my mutation using samtools tview.
however, we I call the mutations using samtools mpileup
But I can't see the mutation in the VCF.
here is the output of pileup (not mpileup):
How can I know why mpileup (or bcftools ?) skipped this mutation ?
Thanks !
Pierre
Hi all,
I know, by capillary sequencing, that one of my samples contains a mutation at position:120458492.
Some reads were aligned with bwa and I can clearly see my mutation using samtools tview.
Code:
120458491 120458501 CCTGCTCTGGGGAGCTATGCCAGGATGGGTGCC ........R........................ .....C..A..................C..... ........C. ...................... ............ ................... ........A..... ............... ,,,,,,,,a,,,,,,,,,,,,,,,, ...... ,,,,,,,,a,,,,,,,,,,,,,,,,,,, . ........A........................ ........A........................ .............................C... ........A........................ ................................. ........A........................ ................................. ................................. ........A........................ ......................C.......... ........A........................ ,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,, ........A........................ ................................. ................................ ............................... .....A........................ ,,,,,,,,,gg,,,,,,,,,,,t,,,, .A........................ .........................
Code:
${SAMTOOLS}/samtools mpileup -uf ${HG19} sample.bam |\ ${SAMTOOLS}/bcftools/bcftools view -bvcg - > snps.bcf ${SAMTOOLS}/bcftools/bcftools view snps.bcf | gzip --best > snps.vcf.gz
here is the output of pileup (not mpileup):
Code:
(...) chr1 120458492 G 26 C.AaaAA.A.A..A.A,A...A,AA^]. JddfhQacfhhgggahehhhhaB[hg (...)
Thanks !
Pierre
Comment