How to decipher CREST outfile?

[Delphine Song]

Dear all,

I'm trying to find SV breakpoints from the output *.predSV.txt file of CREST. But I cannot figure them out.

Let's take the DEL circumstance as an example, are breakpoints left_pos & right_pos, which are the 2nd and 6th columns respectively, or marked in other tags?

Besides, how are consensus sequnences generated in the last column? I first thought they are linkage of both contigs, but later I find out that they are longer than the sum of contig lengths at both positions. I completely have no idea now.

Does anyone have some idea about this?

[RockChalkJayhawk]

from the README

The program will generate a *.predSV.txt file.  The filename will be the input
bam with .predSV.txt appended unless you specify the -p parameter.  Also the
STDERR output has the full list of SVs, including rejected ones.  The output
file *.predSV.txt has the following tab-delimited columns: left_chr, left_pos,
left_strand, # of left soft-clipped reads, right_chr, right_pos, right_strand,
# right soft-clipped reads, SV type, coverage at left_pos, coverage at
right_pos, assembled length at left_pos, assembled length at right_pos,
average percent identity at left_pos, percent of non-unique mapping reads at
left_pos, average percent identity at right_pos, percent of non-unique mapping
reads at right_pos, start position of consensus mapping to genome,
starting chromosome of consensus mapping, position of the genomic mapping of
consensus starting position, end position of consensus mapping to genome,
ending chromsome of consnesus mapping, position of genomic mapping of
consensus ending posiiton, and consensus sequences.  For inversion(INV), the
last 7 fields will be repeated to reflect the fact two different breakpoints
are needed to identify an INV event.

Example of the tumor.predSV.txt file:
4       125893227       +       5       10      66301858        -       4       CTX     29      14      83      71      0.895173453996983       0.230769230769231       0.735384615384615       0.5     1       4       125893135       176     10      66301773        TTATGAATTTTGAAATATATATCATATTTTGAAATATATATCATATTCTAAATTATGAAAAGAGAATATGATTCTCTTTTCAGTAGCTGTCACCTCCTGGGTTCAAGTGATTCTCCTGCCTCTACCTCCCGAGTAGCTGGGATTACAGGTGCCCACCACCATGCCTGGCTAATTTT
5       7052198 -       0       10      66301865        +       8       CTX     0       22      0       81      0.761379310344828       0.482758620689655       0       0       1       5       7052278 164     10      66301947        AGCCATGGACCTTGTGGTGGGTTCTTAACAATGGTGAGTCCGGAGTTCTTAACGATGGTGAGTCCGTAGTTTGTTCCTTCAGGAGTGAGCCAAGATCATGCCACTGCACTCTAGCCTGGGCAACAGAGGAAGACTCCACCTCAAAAAAAAAAAGTGGGAAGAGG
10      66301858        +       4       4       125893225       -       1       CTX     15      28      71      81      0.735384615384615       0.5     0.889507154213037       0.243243243243243       1       10      66301777        153     4       125893154       TTAGCCAGGCATGGTGGTGGGCACCTGTAATCCCAGCTACTCGGGAGGTAGAGGCAGGAGAATCACTTGAACCCAGGAGGTGACAGCTACTGAAAAGAGAATCATATTCTCTTTTCATAATTTAGAATATGATATATATTTCAAAATATGATA