SEQanswers

Go Back   SEQanswers > General



Similar Threads
Thread Thread Starter Forum Replies Last Post
CIGAR inconsist with read length. Does Bowtie2 reedit read sequence? wisense Bioinformatics 5 05-26-2015 11:35 PM
CIGAR and Sequence length incosistent bnfoguy Bioinformatics 8 02-12-2014 04:33 AM
tophat 2.0.0 CIGAR and sequence length are inconsistent laxman RNA Sequencing 3 07-18-2013 09:44 AM
Cuffmerge related query ParthavJailwala Bioinformatics 2 06-13-2013 05:48 AM
samtools view error: CIGAR and sequence length are inconsistent (tophat/bowtie) glacierbird Bioinformatics 2 06-29-2010 01:58 AM

Reply
 
Thread Tools
Old 03-31-2016, 06:20 AM   #1
Jason_Londo
Junior Member
 
Location: Geneva, NY

Join Date: Mar 2016
Posts: 1
Default CIGAR and query sequence are of different length:gmap related

Hello, Iím hoping someone can help me out with this issue. Iíve tried looking for the answer here as well as across the web and canít find a solution. I apologize if Iíve missed something.

I have a trinity based de novo reference transcriptome and Iím attempting to align the transcripts to the reference genome. Iím a novice so Iím following a protocol and am hitting the error below when I attempt to convert my SAM into a BAM file. Iím looking for a fix to the underlying problem as Iíve already tried removing the offending transcript from the SAM file. When I do that, I still get the error, just on a different transcript farther down in the SAM file. Thanks for any guidance.


gmap -n 0 -D /cribi -t 30 -d cribi 588160VVout.fasta Ėf samse > 588160.sam
samtools view ĖSb 588160.sam > 588160.bam
[E::sam_parse1] CIGAR and query sequence are of different length
[W::sam_read1] parse error at line 979
[main_samview] truncated file.


Here is Line 979: The basepairs here are 644. I donít understand how the CIGAR string could be different from the sequence length if the sequence was used to align in the first place.


c33925_g1_i4 0 chr5 17008787 40 92M31I39M21I184M89N33M97N68M151N24M * 0 0 CGACATTTCGCCCCCCTCTTTCGTTTCGCCGACCTCCGAAACACGAAATTTCGCCGAAATTTCGGCGAAAAAAACAGAAATTTTCATCCTTGCCCATAACACAAGATTTCCATTTAAAACCCCCTTAAAACCCTAGCTACAGAGTCCACCGGCAGCGCCTGCGTCGAAACCTGCCCAACACCTCCAGGTCGGGTTAAAGGCTTGCTGGATCAGAGTCTAAACCATCTGGCAAGTTGGTTTTCTGTGGGACGTAACGGTGGAGAGTCTAGAGCTGGTGAAGCGCTTTGTTCTCTGCCCTGGGTGTCTTTAGGGGAGGAGAAACTCAGTTTCGAACTGGTCGCCGGAAGTAAACCCTCTGCGGGTCGGTTGGCCGAGACCAAGAGAGAACGCTCAGACCGGTTATCTGAATTGGAATATATCTCCAATGGAGATTAATTTGGGAAAGCTTCCATTCGATATTGATTTCCATCCTTCCAACACGCTCGTTGCTGCAGGTCTGATTAATGGAGACCTTCACTTGTATCGTTATGGTGCCAATTCCTTACCACAAAGGCTATTGGAGGTTCACGCCCATGGCGAAGAATCTTGTAGAGCTGTTCGTTTTATCAACGAGGGACATGCAATTGTGACCGGTTCTCCAGACC * MD:Z:108GCTT3T9C20G8C31A1T216A33 NH:i:2 HI:i:1 NM:i:63 SM:i:40 XQ:i:40 X2:i:0 XO:Z:UM XS:A:+ PG:Z:M
Jason_Londo is offline   Reply With Quote
Old 03-30-2019, 02:59 AM   #2
jgroh
Junior Member
 
Location: Australia

Join Date: Jan 2019
Posts: 3
Default

I'm wondering whether you ended up finding a solution, why this error is generated? I am experiencing the same issue after a first pass at using GMAP to align a transcriptome assembly to a reference genome.
jgroh is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:34 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO