SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
RNA-Seq: HITS-CLIP: panoramic views of protein-RNA regulation in living cells. Newsbot! Literature Watch 1 09-11-2015 12:48 AM
RNA-Seq: RNA-sequence analysis of human B-cells. Newsbot! Literature Watch 0 05-04-2011 03:50 AM
RNA-Seq: RNA-Seq Analysis of Sulfur-Deprived Chlamydomonas Cells Reveals Aspects of A Newsbot! Literature Watch 0 07-01-2010 03:40 AM
RNA-Seq: Transcriptome and targetome analysis in MIR155 expressing cells using RNA-se Newsbot! Literature Watch 0 06-30-2010 03:00 AM
RNA seq libraries from few hundred cells artem.men Sample Prep / Library Generation 2 03-02-2010 05:04 PM

Reply
 
Thread Tools
Old 04-14-2016, 02:40 AM   #221
seq198
Member
 
Location: Germany

Join Date: Dec 2015
Posts: 10
Default

Quote:
Originally Posted by nucacidhunter View Post
Library can be prepared by shearing amplified cDNA followed by low input DNA library prep. Because of low yield most suitable option will be ThruPLEX. You may adopt the shearing method from following user manual which uses rebranded ThruPLEX DNA-Seq kit.

http://www.clontech.com/AU/Products/...10021:22372:US

Thank you! I had a look at the manual. What disturbed me was the combination of 5´blocked ISPCR primers with Thruplex. I fear that this might cause a loss of 3´and 5´terminal sequences in the lib prep, as the Thruplex adapter will not bind to the blocked termini. If you use unblocked primers than you may get a substantial part of sequences from the oligo dT and TSO sequences.
I´m wondering whether someone has some experience with this??
seq198 is offline   Reply With Quote
Old 04-17-2016, 09:06 AM   #222
HOnsbring
Junior Member
 
Location: Uppsala

Join Date: Apr 2016
Posts: 3
Default Diluting first strand reaction

This is a great thread, I wanna thank everyone that have contributed, especially Simone.

I have tried Smart-seq2 and it works good. However, the cells I am mainly interested in, are small and hard to lyse.

Simone mentioned a trick in this thread that I had not tried, i.e. dilute the first strand reaction. So I tried doing the RT in 2.3 lysis + 2.85 RT = 5.15 ul (which I usually do), but then instead of continuing with a 12.5 ul amplification of the first strand I did a 25 ul KAPA reaction (5.15 ul RT + 0.15 ul 10 uM ISPCR primers + 12.5 ul KAPA + 7.2 ul water). Surprisingly the yield was much lower than usual. Maybe I have to re-optimize the primer concentrations again when diluting. I used 0.1 uM oligo dT in the lysis and standard TSO conc in RT. I guess the carry over TSO and oligo-dT contribute as primers in the next amplification step as well, diluting will make the primer concentration even lower.

An other observation I have made is that I get higher yield in standard 25 ul reactions compared to when I cut all volumes by half. Do others experience the same?

Last edited by HOnsbring; 06-20-2016 at 01:21 AM.
HOnsbring is offline   Reply With Quote
Old 04-19-2016, 03:48 AM   #223
anna.85
Junior Member
 
Location: Oxford

Join Date: Apr 2016
Posts: 5
Default

Quote:
Originally Posted by Simone78 View Post
I had the same problem when working with innate lymphoid cells. Immune cells are small and have much less RNA than, for example, cell lines.
My advice is to block all the oligos with biotin (all!), increasing the number of PCR cycles (23 should be fine), make your own magnetic beads (according to the Rohland & Reich, Genome Res 2010 paper) and using a buffer with a lower % of PEG in order to increase the cutoff (if you are interested I can give you the details), using an oligodT with "V" and not "VN" in the end to avoid weird pairing with the 2 rG in the end of the TSO, as suggested in some papers (for example, look for the "CATS" paper in another thread on this forum). I would also play with oligodT conc (reducing it sometimes help a lot) but I wouldn´t touch the TSO conc.
Some (but not all) of these changes are described in the method part of our last paper --> PMID: 26878113

/Simone
Hi Simone,
i am new in the single cell RNA seq field and I am struggling with the SMARTSeq2 protocol.
I really found very helpful all your posts (and papers) and I hope you can help me. We would like to use the Sera-mag Magnetic Speed-beads, however the preparation protocol is not very clear to me. Could you please give me more details about it?
Thank You very much
anna.85 is offline   Reply With Quote
Old 04-19-2016, 03:55 AM   #224
kobeho24
Member
 
Location: HKUST, Hong Kong

Join Date: Apr 2015
Posts: 32
Default

Quote:
Originally Posted by anna.85 View Post
Hi Simone,
i am new in the single cell RNA seq field and I am struggling with the SMARTSeq2 protocol.
I really found very helpful all your posts (and papers) and I hope you can help me. We would like to use the Sera-mag Magnetic Speed-beads, however the preparation protocol is not very clear to me. Could you please give me more details about it?
Thank You very much
Check this out! It works pretty well on our hand.
http://openwetware.org/wiki/SPRI_bead_mix
http://seqanswers.com/forums/showthr...ghlight=ampure
kobeho24 is offline   Reply With Quote
Old 04-22-2016, 09:20 AM   #225
anna.85
Junior Member
 
Location: Oxford

Join Date: Apr 2016
Posts: 5
Default

Hi all,
I am writing to get some piece of advice on a problem that came up during our single cell experiment.
We sequenced 177 human cells by using the SmartSeq2 protocol described in Picelli et al. The cells have been treated with antibiotic, sorted in lysis buffer and immediately frozen (after quick vortexing and spinning down).
We performed reverse transcription and PCR pre-amplification by using the SuperScript II and KAPA kit, as suggested in the protocol and Ampure XP beads for cleaning (0,8:1 ratio).
By random analysis of the cells with the bioanalyzer we observed that the pattern of the cDNA was not consistent, some cells, indeed, presented a “weird” peak at 300nm (the peak was much more “attenuated” in the bulk samples). Despite our doubts, the sequencing company reassured us saying that it could happen, so they proceed with the library prep and the sequencing.
After sequencing we found that the majority of our reads mapped to bacterial ribosomal 16S!!!! we got a massive (70-75%) ribosomal bacterial 16S contamination. Moreover, our bioinformatician showed us that the contamination came from different bacterial families, so not one or few bacterial species!
At this point we started a series of exp to try to understand where this contamination comes from, but we still haven’t figured it out!
1) we prepared, exactly in the same conditions, another plate. After the PCR purification, we pulled together the cDNA of 6-7 single cells and we run a PCR for the r16S. Unluckily we got a strong signal! This made us understand that the contamination happened in our laboratory and not at the sequencing company.
2) We run a PCR for r16S on: lysis buffer, EB buffer and ddH2O used during the exp. No one of them was contaminated
3) We thought that cells might have been contaminated (even if they are treated with antibiotic, we thought that bacterial component, like DNA, may stay attached to them and be sorted and carried on during the process). We sorted 5000 cells in PBS and we performed a gDNA extraction (according to both eukaryotic and prokaryotic protocol), then we run a PCR for r16S, but we could not see any bands (however we had the GAPDH as control which showed clear bands)
At this point we started thinking that the problem was related to the SuperScriptII or the KAPA (especially after reading the other comments in these blog).
4) We sorted again the same cells in strips and we processed them in different ways
- 2 strips immediately after sorting were used for a PCR for r16S. We didn’t see any bands.
- 2 other strips went through the RT transcription process and then immediately used as template for a PCR for r16S. Also in this case we didn’t see any bands.
- 2 other strips went through all the steps (RT and PCR pre amplification and PCR cleaning). In this case we saw a clear band!!!
However, the situation is quite puzzling, infact our “blank (= no cell sorted inside) well” didn’t show any band. This make me think that both KAPA and Superscript are not contaminated.
Only in the well in which we have sorted cells, after the PCR pre-amplification it seems to appear the r16S band!!!!
It is possible that the Reverse Transcriptase (SSII) contains such a small amount of bacterial DNA contamination that it is necessary a double PCR to see it?
Or is it possible that our cells carry such a small bacterial DNA contamination that it is necessary a double PCR to see it?
We are performing other tests by using different cell type and different condition (es sorting cells, performing PCR pre-amplification with KAPA and then PCR for r16S, omitting the RT step), but we are really get mad with this.
If anyone can help us to solve this problem, it would be really appreciated.
anna.85 is offline   Reply With Quote
Old 04-22-2016, 09:36 AM   #226
HOnsbring
Junior Member
 
Location: Uppsala

Join Date: Apr 2016
Posts: 3
Default

Hello anna.85,

I work with poorly studied microbes, so I have to assemble my data de novo. Therefore contamination can be extra problematic for me since I do not map my reads to a reference. I take extra precautions such as UV irradiating all reagents and tubes before use except the primers, RNase inhibitor, KAPA and SSII polymerase. I do the UV irradiation in a crosslinker from techtum.

However, the SSII polymerase seems to be contaminated some times and then the situation is much harder. If the cell you work with is rather big and give a high yield of cDNA such contamination should not be too much of a problem according to my experience.
HOnsbring is offline   Reply With Quote
Old 04-25-2016, 09:57 AM   #227
anna.85
Junior Member
 
Location: Oxford

Join Date: Apr 2016
Posts: 5
Default

Hi Adamreid,
we have exactly the same situation (see post #225 in thi section)!!!
we did a single cell exp following the SMARTSeq2 protocol and we got lots of 16s bacteria contamination.
We run lots of tests (16S PCR ) with multiple conditions (different kind of cells, cells post-sorting, cells post RT, cells post PCR cleaning etc) and, by exclusion, we think that the SSII is contaminated, whereas we see the PCR bands for the 16S only after 2 run of PCR amplification.

we are thinking to use the Maxima H-...
Did you manage to solve your problem?
anna.85 is offline   Reply With Quote
Old 04-25-2016, 10:03 AM   #228
anna.85
Junior Member
 
Location: Oxford

Join Date: Apr 2016
Posts: 5
Default

Quote:
Originally Posted by adamreid View Post
We are trying to sequence RNA from individual small cells.

We are sorting by FACS and using SmartSeq2 and Nextera XT to make libraries.

We have had several problems.

We get rRNA contamination from both E. coli (perhaps due to contaminated reverse transcriptase) and from our target organism. This is strange because SmartSeq2 should only amplify polyA mRNAs.

Secondly when we sequence the libraries we get adaptor contamination, sometimes from the strand-switching oligo and also from the Nextera transposase.

Has anyone noticed similar problems?

Cheers,

Adam
Hi Adamreid,
we have exactly the same situation (see post #225 in thi section)!!!
we did a single cell exp following the SMARTSeq2 protocol and we got lots of 16s bacteria contamination.
We run lots of tests (16S PCR ) with multiple conditions (different kind of cells, cells post-sorting, cells post RT, cells post PCR cleaning etc) and, by exclusion, we think that the SSII is contaminated, whereas we see the PCR bands for the 16S only after 2 run of PCR amplification.

we are thinking to use the Maxima H-...
Did you manage to solve your problem?
anna.85 is offline   Reply With Quote
Old 05-05-2016, 07:18 AM   #229
anna.85
Junior Member
 
Location: Oxford

Join Date: Apr 2016
Posts: 5
Default

Quote:
Originally Posted by Simone78 View Post
I had the same problem when working with innate lymphoid cells. Immune cells are small and have much less RNA than, for example, cell lines.
My advice is to block all the oligos with biotin (all!), increasing the number of PCR cycles (23 should be fine), make your own magnetic beads (according to the Rohland & Reich, Genome Res 2010 paper) and using a buffer with a lower % of PEG in order to increase the cutoff (if you are interested I can give you the details), using an oligodT with "V" and not "VN" in the end to avoid weird pairing with the 2 rG in the end of the TSO, as suggested in some papers (for example, look for the "CATS" paper in another thread on this forum). I would also play with oligodT conc (reducing it sometimes help a lot) but I wouldn´t touch the TSO conc.
Some (but not all) of these changes are described in the method part of our last paper --> PMID: 26878113

/Simone
Hi Simone,
In your last paper (PMID:26878113 ) in M&M is written you used 10U/uL of RNase inhibitor in lysis buffer.
If so, according to the volume you used, 1.9uL of Triton 0,4% and 0,1 uL of RNase inhibitor, the stock concentration of RNase should be 200U/uL…
I cannot find this RNase inhibitor, can you help me?
I was wondering if maybe it is a typo and it is 1U/uL…
anna.85 is offline   Reply With Quote
Old 05-10-2016, 12:30 PM   #230
kishorebiotech
Junior Member
 
Location: Boston

Join Date: Sep 2012
Posts: 1
Default Read Length discrepancy

Hi Simone, I was looking at Bioanalyzer traces from Pg.180 of your paper (PMID: 24385147). What do you think about the size discrepancy between MEF cell at 2Kb vs T cell 700bp. I see a hump from T-cell at 2Kb. Do you think the hump(@2Kb) is the real peak and the 700bp some kind of artifact or RNA degradation?
kishorebiotech is offline   Reply With Quote
Old 06-14-2016, 11:52 AM   #231
iamahappyann
Junior Member
 
Location: USA

Join Date: Aug 2011
Posts: 1
Default

Hi All,

Thank you for all your contribution to this topic, especially Simone. I learned a lot from it and started to prepare my scRNA form my project.

I have a stupid question about the oligoDT primer: why all the scRNA-seq methods use CDS to olidodT instead of using olidodtVN?
CDS-oligodtVN: 5'>AAGCAGTGGTATCAACGCAGAGTACT30VN ; OligodtVN: 5'>T30VN.

I understand that the CDS sequence is the same as TSO sequence, so one ISPCR primers could be used for amplification.
But it is necessary to use single PCR primer? Could the OligodtVN used for cDNA synthesis and Oligodt+ISPCR for cDNA amplification?

Thank you in advance.
iamahappyann is offline   Reply With Quote
Old 06-20-2016, 01:19 AM   #232
HOnsbring
Junior Member
 
Location: Uppsala

Join Date: Apr 2016
Posts: 3
Default

iamahappyyann, you could probably make it work. However I guess you would get lower yield. Adding the primer according to Smartseq2 gives you higher effective primer concentration compared to if you use the same total molar of ISPCR + oligodT.

Also using only one primer give you this suppression effect: http://www.evrogen.com/img/PCR-supression-large.png which you will not get if you use ISPCR + oligodT.
HOnsbring is offline   Reply With Quote
Old 06-29-2016, 10:38 AM   #233
AiryLarry
Junior Member
 
Location: Oxford

Join Date: Jul 2015
Posts: 1
Default

Hi Simone, can we substitute SmartScribe for Maxima -H in your SmartSeq protocol without changing the rest of the reagents like RNAseH etc?

cheers!
AiryLarry is offline   Reply With Quote
Old 07-10-2016, 05:32 PM   #234
chubukovp
Junior Member
 
Location: US

Join Date: Jul 2013
Posts: 1
Default

Quote:
Originally Posted by Simone78 View Post
Hi,
even if your cells have a lot of RNA I wouldn´t do it. This is only my opinion, others might think differently. Every time you transfer RNA before any amplification step you lose molecules. I would sort directly into the lysis buffer, but be aware that 0.2% Triton might not be sufficient for lysing so many cells.
Best,
Simone
Simone, could you clarify:
did you use Betaine+6mM Mg2+ with supplied superscript IV buffer, or you used the buffer from SMART-seq2 protocol? The tech support from Life Tech say that the buffer is the most important part of SSIV system.
Also, if the 3bp hybridization during 5' switch is an issue, could it be useful to lower the temperature to 25-37C for a short time to enhance the switch?
chubukovp is offline   Reply With Quote
Old 07-13-2016, 10:15 AM   #235
SunPenguin
Member
 
Location: Boston

Join Date: Aug 2015
Posts: 38
Default

Has anyone here looked at what the TSO would be doing in subsequent PCR reactions (i.e. could it cause TSO founded amplification)?
SunPenguin is offline   Reply With Quote
Old 10-12-2016, 05:19 AM   #236
Steve giant
Junior Member
 
Location: Italy

Join Date: Mar 2016
Posts: 2
Default Superscript-II - contamination issue

Hello everybody,

I also got bad results in my single cell application (WTA) with a recently acquired batch of Superscript II
I followed your advice on complaining to Life Technologies about the SSII contamination.
Actually, they have set-up an assay to detect contaminations originating from E. coli.

My and their question is to know the acceptable level of contamination for single cell WTA applications. I mean the number of copies of contaminating nucleic acid for each mg or Unit of enzyme.

Zero cannot work, is not feasible in a purification process.

What's your suggestion?

Thank you.

S.
Steve giant is offline   Reply With Quote
Old 10-12-2016, 06:48 AM   #237
JJMS
Junior Member
 
Location: Netherlands

Join Date: Jan 2013
Posts: 5
Default TSO in qPCR

Quote:
Originally Posted by SunPenguin View Post
Has anyone here looked at what the TSO would be doing in subsequent PCR reactions (i.e. could it cause TSO founded amplification)?
Hi SunPenguin, yes we did. We are sorting single B cells and before we send for sequencing we apply a qPCR panel to test for T/B/NK presence. If the transcripts are there you'll find the expected singnal back with qPCR. But if the samples are negative (f.i. CD56 qPCR on a sorted T cell) then often we see a complete jungle of bands. If it's the TSO or oligo-dT, I don't know but we have to run an agarose gel afterwards to be sure.
JJMS is offline   Reply With Quote
Old 10-13-2016, 06:29 PM   #238
ipeikon
Junior Member
 
Location: New York

Join Date: Nov 2011
Posts: 4
Default rRNA reads from bacteria

Hi all,

I'm also seeing issues with lots of rRNA - mostly from bacteria (23s?). I'm curious if when you have super low input RNA this is more common. One thought is that I could reduce the oligoDT concentrations. Has anyone tried this?

Note: I do not think my contamination is coming from the RT enzyme. I am using Maxima RH- and also most of the bacterial species I see make sense considering my tissue source.

-Ian
ipeikon is offline   Reply With Quote
Old 10-14-2016, 12:41 AM   #239
Steve giant
Junior Member
 
Location: Italy

Join Date: Mar 2016
Posts: 2
Default

Quote:
Originally Posted by ipeikon View Post
Hi all,

I'm also seeing issues with lots of rRNA - mostly from bacteria (23s?). I'm curious if when you have super low input RNA this is more common. One thought is that I could reduce the oligoDT concentrations. Has anyone tried this?

Note: I do not think my contamination is coming from the RT enzyme. I am using Maxima RH- and also most of the bacterial species I see make sense considering my tissue source.

-Ian
Hi Ian,

in my samples, the 2 main represented transcripts are 16S and 23S ribosomal RNA.
Remaining reads match RNAseP, 50S ribosomal subunit genes.

Obviously, the contamination is inversely proportional to the amount of input RNA as a result of a different ratio between the different substrates (specific targets and contaminants). I didn't try to reduce oligoDT concentration.

I'll keep you up-to-date.

S.
Steve giant is offline   Reply With Quote
Old 11-09-2016, 01:27 PM   #240
wanze
Junior Member
 
Location: Europe

Join Date: Jul 2016
Posts: 1
Default rRNA and mitochondria RNA

Quote:
Originally Posted by adamreid View Post
We are trying to sequence RNA from individual small cells.

We are sorting by FACS and using SmartSeq2 and Nextera XT to make libraries.

We have had several problems.

We get rRNA contamination from both E. coli (perhaps due to contaminated reverse transcriptase) and from our target organism. This is strange because SmartSeq2 should only amplify polyA mRNAs.

Secondly when we sequence the libraries we get adaptor contamination, sometimes from the strand-switching oligo and also from the Nextera transposase.

Has anyone noticed similar problems?

Cheers,

Adam

Hi Adam and all,

I also have that problem and do not know why. When I sequence the library, , 40% of the unique mapped reads are 18s RNA and mitochondrial RNA. I am using the LNA-TSO (all oligos and PCR primers are biotinated) and Maxima H- RTase.

I also have two weird peaks at around 1.3 kb and 1.8 kb in the cDNA profile, even when I use 10 pg purified total RNA as input. I think the 1.8kb peak might be the 18s rRNA. But since it is reverse transcripted with oligo-dT, it does not make sense.

Have anyone saw and solved that problem?

ps. When I use supersciptII with the other setting exactly the same, the two peaks disappear, but with many peaks around 600 bp, which we all know is the E.coli RNA contamination.

Best,
Wanze
Attached Files
File Type: pdf 0 pg RNA.pdf (57.7 KB, 82 views)
File Type: pdf 5 pg RNA.pdf (78.1 KB, 85 views)
wanze is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:32 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO