SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Standalone BLAST output MattN Bioinformatics 8 02-02-2015 12:17 AM
error with sam output ->Parse error at line xxxxx: missing colon in auxiliary data manore Bioinformatics 11 11-25-2013 02:50 PM
Standalone Blast output jomaco Bioinformatics 1 01-31-2012 08:18 AM
Local BLAST: How to parse the "non matching" elements ? Giorgio C Bioinformatics 2 09-07-2011 08:43 AM
convert blast output rururara Bioinformatics 1 04-08-2011 01:48 AM

Reply
 
Thread Tools
Old 07-08-2011, 06:31 PM   #1
empyrean
Member
 
Location: EU

Join Date: Sep 2010
Posts: 52
Default Parse Web Blast Output

I have installed NCBI wwwblast at our local server and blast is running absolutely fine. I wanted to refine the html output which the blast is showing. For example, while showing alignment description, i wanted to make the "Subjcet" as a hyperlink and guide it to show in gbrowse. Can anyone suggest me how to achieve this?

For example, the default output is shown below.

Code:
   >gb|FJ032364.1| hypothetical resistant gene, complete
           cds
          Length = 1905

 Score =  634 bits (320), Expect = e-179
 Identities = 320/320 (100%)
 Strand = Plus / Plus


Query: 1   atgaatagtgtattgaatactggaagaactactatttgtgatgcgtataatgtagcggct 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1   atgaatagtgtattgaatactggaagaactactatttgtgatgcgtataatgtagcggct 60
I would like to see "Sbjct:" as a hyperlink created by me. I have the www libraries but dont know which one to change this.. Please some one suggest me
empyrean is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:27 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO