SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
[BWA] Calculate % of reads not aligned to reference qesecir Bioinformatics 18 11-04-2014 03:03 AM
BWA Combined Reference vs sequential alignment Tomi Bioinformatics 1 01-17-2012 02:51 PM
BWA: reference sequences longer than 4GB ElMichael Bioinformatics 1 06-06-2011 01:22 PM
BWA with reference containing N's Protaeus Bioinformatics 1 05-24-2011 05:16 PM
BWA error and reference index satishkumar Introductions 1 11-19-2010 08:22 AM

Reply
 
Thread Tools
Old 09-14-2011, 06:56 AM   #1
cklopp
Member
 
Location: Toulouse France

Join Date: Sep 2009
Posts: 12
Default bwa alignement outside of the reference sequence

Hi,

Using bwa (Version: 0.5.9-r16) we encountered cases where the proposed alignment position was outside of the reference sequence.
In the example hereunder the alternative alignment position of the read starts, on the forward strand, at position 145240300 on a chromosome of length 145240301

@SQ SN:CHR13 LN:145240301
@SQ SN:CHR14 LN:148515138
@SQ SN:CHR1 LN:295534705
@PG ID:bwa PN:bwa VN:0.5.9-r16
[bwa_aln_core] convert to sequence coordinate... 9.64 sec
[bwa_aln_core] refine gapped alignments... 4.18 sec
[bwa_aln_core] print alignments... HWI-ST314_0106:4:1202:17139:18375#0 16 CHR15 132557769 0 101M * 0 0 ACAGAATTCTATATCCAGTGAGAATATCCTTCAGGTATGAAAGTGAAAAGAGATTTTCTCAGATGAAGGAAAACCGAGTGAATTTGTTGCCAGTGGAGCTA JPJJS`QKQQKQKK[[QJRJJRJK`J`KbK[`Q`RJIIPPP^ceSI^I^IOOHIIOOOOacgINOa_aBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB XT:A:R NM:i:4 X0:i:2 X1:i:1 XM:i:4 XO:i:0 XG:i:0 MD:Z:8G26A50C10T3 XA:Z:CHR13,+145240300,101M,4;CHR14,-18932,101M,5;

Any idea of what happens?

Cheers

Christophe
cklopp is offline   Reply With Quote
Old 09-14-2011, 09:25 AM   #2
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 912
Default

bwa concatenates the reference sequences together, so if your read hangs off the end of its reference, that'll happen. But bwa should give it a 4 in the binary flag, so that's how you know the mapping isn't quite right.
swbarnes2 is offline   Reply With Quote
Reply

Tags
alignment problem, bwa, wrong position

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:28 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO