Trim Galore output issue

shocker8786 · 10-09-2013, 05:55 AM

I have both RRBS and RNAseq datasets that I'm trying to filter for quality and trim adaptors using Trim Galore. When I run it on the RRBS fq files using the --RRBS option, the resulting fq output looks fine:

@HWI-ST330:336

274FACXX:3:1101:13152:1997 1:N:0:CTTGTA
NGGGTTGTTTTATGGAGAGCGGAGGGT
+
#4=DDDFDHHHHHJJIJIIGJJIIJJ?
@HWI-ST330:336

274FACXX:3:1101:14593:1999 1:N:0:CTTGTA
NGGTAATTCGTTTTTTATAAGGCGAAT
+
#1=DFFFFHHHHHJJJJJJJHGIJJJJ
@HWI-ST330:336

274FACXX:3:1101:18911:1998 1:N:0:CTTGTA
NGGGGTTTAGACGTAGTAGGTGTTTT
+
#1=DFDDFHHHHHGHJGHIJAFFHIJ

But when I run it on the RNAseq samples without the --RRBS option, there are additional spaces in the fastq output:

@DBRHHJN1:326:C233EACXX:1:1101:1305:1193 1:N:0:ATCACG
CTTTNTGTGGCTCAGGATGGAGGTGGCCACATTGGCCAGCAACTCAGCCAGGCCGGGGCCTTCCTTCCCAGCAATTCGAGGCGCGGCCAGCGCCTGCCGC

+
???D#2=ADDDDDIIIIEFIEEF+CEDE>DDEIIEDBED=DDCEBDD@CDDDCDDIAD>@?AAAAAAA?AA=??AAA?E?>5;>;>95;8<;;>>???>>

@DBRHHJN1:326:C233EACXX:1:1101:1287:1222 1:N:0:ATCACG
CTTGNAAATGGCGTCAAAGGTGGCCTTGGCGAAGTTGCCCAGGGTGGCAGTGCAGCCCCTGGCAGAGGTGTAGCAGTCATCAATTCCTGCCATCATCAGC

+
?@@D#2=AFHH?FH<ECFHHHGGEEGEGH@D@)?DHI9?BCFGIHII=@?7A;7?>BB?ACCA=?(98,<C:C:5,53:@>>4:@::@@CB>@93>>:::

@DBRHHJN1:326:C233EACXX:1:1101:1252:1244 1:N:0:ATCACG

I've tried running it a few different ways, and discovered that I only get the output with added spaces when I don't use the --RRBS option. My question is how do I fix this issue? I don't want to use the --RRBS option with the RNAseq data, as it will remove an additional 2bp from the trimmed reads. Is there a way to prevent Trim Galore from adding these spaces? Or is there a way for me to remove the spaces from the output files? Thanks!

choishingwan · 10-09-2013, 06:43 AM

The simplest way might be to use awk? (but will be slow)

Quote:

awk '{if(length($0)>=1)print $0}' input.fq

something like that, I haven't tested the code though...

fkrueger · 10-09-2013, 08:06 AM

This was a bug that had been introduced accidentally... If you get the latest version of Trim Galore it should be fine, sorry for the inconvenience caused. This is from the latest release notes:

Code:

10-09-13: Version 0.3.3 released

    Fixed a bug what was accidentally introduced which would add an additional empty line in single-end trimming mode

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Quality-, adapter- and RRBS-trimming with Trim Galore!	fkrueger	Bioinformatics	138	11-12-2020 04:58 PM
trim galore error	JQL	Bioinformatics	23	02-17-2015 12:21 PM
FastQC output: Do I trim these?	wilson90	Bioinformatics	1	08-16-2013 01:01 AM
Do I need to run trim galore even if my reads are of good quality?	genomics_search	Bioinformatics	1	03-06-2013 12:30 PM
How to integrate Trim Galore in Galaxy?	sachitad	RNA Sequencing	2	10-19-2012 03:54 AM

10-09-2013, 08:06 AM	#3
fkrueger Senior Member Location: Cambridge, UK Join Date: Sep 2009 Posts: 625	This was a bug that had been introduced accidentally... If you get the latest version of Trim Galore it should be fine, sorry for the inconvenience caused. This is from the latest release notes: Code: 10-09-13: Version 0.3.3 released Fixed a bug what was accidentally introduced which would add an additional empty line in single-end trimming mode

10-09-2013, 05:55 AM	#1
shocker8786 Member Location: Urbana Illinois Join Date: Jan 2013 Posts: 28	Trim Galore output issue I have both RRBS and RNAseq datasets that I'm trying to filter for quality and trim adaptors using Trim Galore. When I run it on the RRBS fq files using the --RRBS option, the resulting fq output looks fine: @HWI-ST330:336274FACXX:3:1101:13152:1997 1:N:0:CTTGTA NGGGTTGTTTTATGGAGAGCGGAGGGT + #4=DDDFDHHHHHJJIJIIGJJIIJJ? @HWI-ST330:336274FACXX:3:1101:14593:1999 1:N:0:CTTGTA NGGTAATTCGTTTTTTATAAGGCGAAT + #1=DFFFFHHHHHJJJJJJJHGIJJJJ @HWI-ST330:336274FACXX:3:1101:18911:1998 1:N:0:CTTGTA NGGGGTTTAGACGTAGTAGGTGTTTT + #1=DFDDFHHHHHGHJGHIJAFFHIJ But when I run it on the RNAseq samples without the --RRBS option, there are additional spaces in the fastq output: @DBRHHJN1:326:C233EACXX:1:1101:1305:1193 1:N:0:ATCACG CTTTNTGTGGCTCAGGATGGAGGTGGCCACATTGGCCAGCAACTCAGCCAGGCCGGGGCCTTCCTTCCCAGCAATTCGAGGCGCGGCCAGCGCCTGCCGC + ???D#2=ADDDDDIIIIEFIEEF+CEDE>DDEIIEDBED=DDCEBDD@CDDDCDDIAD>@?AAAAAAA?AA=??AAA?E?>5;>;>95;8<;;>>???>> @DBRHHJN1:326:C233EACXX:1:1101:1287:1222 1:N:0:ATCACG CTTGNAAATGGCGTCAAAGGTGGCCTTGGCGAAGTTGCCCAGGGTGGCAGTGCAGCCCCTGGCAGAGGTGTAGCAGTCATCAATTCCTGCCATCATCAGC + ?@@D#2=AFHH?FH<ECFHHHGGEEGEGH@D@)?DHI9?BCFGIHII=@?7A;7?>BB?ACCA=?(98,<C:C:5,53:@>>4:@::@@CB>@93>>::: @DBRHHJN1:326:C233EACXX:1:1101:1252:1244 1:N:0:ATCACG I've tried running it a few different ways, and discovered that I only get the output with added spaces when I don't use the --RRBS option. My question is how do I fix this issue? I don't want to use the --RRBS option with the RNAseq data, as it will remove an additional 2bp from the trimmed reads. Is there a way to prevent Trim Galore from adding these spaces? Or is there a way for me to remove the spaces from the output files? Thanks!