MiSeq Index Primer Sequence

krispy · 12-24-2013, 11:47 PM

Hi all,

I am looking for the exact sequence for the default MiSeq Index Primer. Can anyone help me to check if this is the correct one?

5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC

and probably provide me if there is any reliable source where Illumina confirms this is the correct sequence?

Thank you very much.
Merry Christmas.

gringer · 12-25-2013, 12:51 AM

You mean these sequences?

http://supportres.illumina.com/docum...enceletter.pdf

krispy · 12-25-2013, 01:10 AM

Thanks for the reply.

I actually got the sequence from the customer letter too (here in: oligonucleotide sequences for the multiplexing sample prep oligo only kit - multiplexing index read sequencing primer).

but may I know is there somewhere stated that this is also the MiSeq Index Primer that comes together with the kit? I wish to synthesize the same primer but load it as custom index primer in different well, I am kinda sure the sequence I got above will work as a custom index primer too even it's not the same with the default one (because it will be run as custom anyway), but I was given a "task" to find out the exact MiSeq default index primer.

gringer · 12-26-2013, 03:31 AM

MiSeq uses TruSeq and Nextera kits, so I expect that the TruSeq/Nextera primer sequences used in that document are the correct ones. You would probably need to contact Illumina to confirm that (info@illumina.com, or customerservice@illumina.com).

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
MiSeq Custom Sequencing Primer Tm?	pmiguel	Illumina/Solexa	43	11-12-2015 12:52 PM
Miseq FASTQ sequence identifier missing index read?	rnaeye	Illumina/Solexa	17	05-25-2015 01:21 PM
Miseq illumina primer	rozitaa	General	1	06-04-2013 04:02 AM
Alternative index primer	Andrew_Slatter	Illumina/Solexa	8	02-16-2011 11:39 AM
Query about modification of PCR primer index?	fusu	Illumina/Solexa	0	02-23-2010 09:46 PM

12-24-2013, 11:47 PM	#1
krispy Junior Member Location: Singapore Join Date: Apr 2013 Posts: 7	MiSeq Index Primer Sequence Hi all, I am looking for the exact sequence for the default MiSeq Index Primer. Can anyone help me to check if this is the correct one? 5' GATCGGAAGAGCACACGTCTGAACTCCAGTCAC and probably provide me if there is any reliable source where Illumina confirms this is the correct sequence? Thank you very much. Merry Christmas.

12-25-2013, 12:51 AM	#2
gringer David Eccles (gringer) Location: Wellington, New Zealand Join Date: May 2011 Posts: 838	You mean these sequences? http://supportres.illumina.com/docum...enceletter.pdf

12-25-2013, 01:10 AM	#3
krispy Junior Member Location: Singapore Join Date: Apr 2013 Posts: 7	Thanks for the reply. I actually got the sequence from the customer letter too (here in: oligonucleotide sequences for the multiplexing sample prep oligo only kit - multiplexing index read sequencing primer). but may I know is there somewhere stated that this is also the MiSeq Index Primer that comes together with the kit? I wish to synthesize the same primer but load it as custom index primer in different well, I am kinda sure the sequence I got above will work as a custom index primer too even it's not the same with the default one (because it will be run as custom anyway), but I was given a "task" to find out the exact MiSeq default index primer.

12-26-2013, 03:31 AM	#4
gringer David Eccles (gringer) Location: Wellington, New Zealand Join Date: May 2011 Posts: 838	MiSeq uses TruSeq and Nextera kits, so I expect that the TruSeq/Nextera primer sequences used in that document are the correct ones. You would probably need to contact Illumina to confirm that (info@illumina.com, or customerservice@illumina.com).