|
|
|
|
|||||||
Similar Threads
|
||||
| Thread | Thread Starter | Forum | Replies | Last Post |
| SAM/BAM format to wiggle format | pinki999 | Bioinformatics | 19 | 08-12-2015 01:35 AM |
| Looking process to convert gff3 format into ace format or sam format | andylai | Bioinformatics | 1 | 05-17-2011 03:09 AM |
| SAM result format required in cufflinks | arthur.yxt | Bioinformatics | 15 | 11-12-2010 02:11 AM |
| New: updated SpliceMap supports SAM format/cufflinks | john_mu | Bioinformatics | 9 | 05-29-2010 01:45 PM |
| New: updated SpliceMap supports SAM format/cufflinks | john_mu | General | 0 | 05-20-2010 06:11 PM |
 |
|
|
Thread Tools |
11-07-2010, 11:51 PM
|
#1 |
|
Member
Location: asia Join Date: Dec 2009
Posts: 80
|
SAM to CUFFLINKS SAM format
Does any one know how to convert SAM to cufflinks SAM format ?
Even manual is fine I can write a simple code that converts manual to command line. All I want to know is is the first sequence is really SAM or not (It should be). If it is what coulmn actually represents original SAM format? Thanx Code:
IL26_1184:1:109:734:594 67 clone::AL662826.11:1:145431:1 27827 0 36M * 0 80 GGCCGCTGTGCGCGCCCCGCCTGCTGGACCACTTCA >>>>>>><<>>>>>>>>>>>>8<<>8,,<<3<<8<3 MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:0 IL26_1184:1:109:734:594 147 clone::AL662826.11:1:145431:1 27871 0 36M * 0 -80 CTGCCGGCGTTGCTCAAGCTGGCCTGCGGAGGCGAC 7.6<4667<64<<47<<<<.<<<<2<<<<<<<<<<< MF:i:18 Aq:i:0 NM:i:0 UQ:i:0 H0:i:3 H1:i:0 Code:
s6.25mer.txt-913508 16 chr1 4482736 255 14M431N11M * 0 0 \ CAAGATGCTAGGCAAGTCTTGGAAG IIIIIIIIIIIIIIIIIIIIIIIII NM:i:0 XS:A:- |
|
|
|
11-08-2010, 05:51 AM
|
#2 |
|
Senior Member
Location: Stockholm, Sweden Join Date: Feb 2008
Posts: 319
|
It looks as if your first snippet could be SAM. Usually the UNIX command
sort -k3,3 -k4,4n in.sam > out.sam will be sufficient for Cufflinks to accept a sam file. |
|
|
|
|
11-09-2010, 08:03 AM
|
#3 |
|
Junior Member
Location: united kingdom Join Date: Oct 2008
Posts: 4
|
They are both SAM format however the second line contains the XS:A field. This field allows cufflinks to know which strand the RNA that produced this read came from. Cufflinks will not accept sam files that are not sorted and do not have this field. You can write a simple script to modify your sam file to include this information by taking the bit wise flag in field 2 where the strand information is stored and translating it.
Hope that helps. |
|
|
|
|
11-09-2010, 06:20 PM
|
#4 | |||
|
Member
Location: asia Join Date: Dec 2009
Posts: 80
|
But the data I have is Illumina-single end. As per my knowledge I lllumina still doesn't have strand specific data ??
Anyways I did what you said but no use. see below after adding strand info Using this command Quote:
Quote:
Quote:
Last edited by repinementer; 11-09-2010 at 06:58 PM. |
|||
|
|
|
|
03-15-2012, 09:53 AM
|
#5 |
|
Junior Member
Location: UK Join Date: Jan 2012
Posts: 7
|
Hi all,
I was facing the same problem when I tried to run Cufflinks. But when you provide your SAM file with the header then you will not experience this error. It worked for my data but I am not sure about other datasets. But may be worth trying this. |
|
|
|
|
| Thread Tools | |
|
|
