SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
bowtie- paired end - no alignments madsaan Bioinformatics 1 06-27-2011 02:24 PM
Bowtie: number of alignments Nick Bioinformatics 1 03-04-2011 11:58 AM
Bowtie - SOLiD : Weird decoding examples smarthey Bioinformatics 0 02-21-2011 03:07 AM
Bowtie colorspace output has less NT than input reads SongLi Bioinformatics 5 01-20-2011 08:39 AM
Help with Bowtie, only unique alignments khb General 1 12-16-2010 01:35 AM

Reply
 
Thread Tools
Old 02-09-2011, 06:03 AM   #1
rlegendre
Junior Member
 
Location: Paris, France

Join Date: Sep 2010
Posts: 7
Default Decoding colorspace alignments by Bowtie

Hi all,

I am using Bowtie to map SOLID read in horse genome reference, in order to discover new miRNA. I employ the commande line :
Code:
./bowtie --sam -f -a -m 6 -C -v 2 --best --strata <path_fasta> <path_sam>
and I obtain this output :


2_18_1468_F3 0 3 19908716 255 22M ACCACAGGGTAGAACCACGGTC IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:20A1 NM:i:1 CM:i:2
2_18_1468_F3 0 18 17330428 255 22M CAACACTTTGCTCCAACAAACT Iqqqqqqqqqqqqqqqq!!qqI XA:i:2 MD:Z:21A0 NM:i:1 CM:i:2
2_18_1468_F3 0 6 76907837 255 22M TGCACACCCATCTTGGTGCCAG I!!qq!!qqqqqqqqqqqqqqI XA:i:2 MD:Z:22 NM:i:0 CM:i:2
2_18_1468_F3 0 22 26347698 255 22M GTTGTTCCCATCTTGGTGCCTC Iqqq!!qqqqqqqqqqqqq!!I XA:i:2 MD:Z:22 NM:i:0 CM:i:2
2_18_1468_F3 16 21 55207881 255 22M GACCGTGGGGAGCGGGACACCA Iqqqqqq!!qqq!!qqqqqqqI XA:i:2 MD:Z:22 NM:i:0 CM:i:2

In my bowtie manual interpretation, the NM field represent mismatch between decoding read and reference, i.e. mismatchs in nucleotidic alignment, and CM field colorspace mismatch. So, in my SAM file, for a same read with 2 colorspace mismatch, number of nucleotide mismatch change ?? I don't understand why ! Anybody who work with SOLID read can help me ?

Moreover, I test --snpfrac option of bowtie, and once again, results are amazing. For the same read I have :

2_18_1468_F3 0 6 76907837 255 22M TGGTGTCCCATCTTGGTGCCAG IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:2C0A0C0A16 NM:i:4 CM:i:2
2_18_1468_F3 0 22 26347698 255 22M TGGTGTCCCATCTTGGTGCCAG IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:0G0T0T0G0T15T0C0 NM:i:7 CM:i:2
2_18_1468_F3 0 3 19908716 255 22M ACCACAGGGTAGAACCACGGTC IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:20A1 NM:i:1 CM:i:2
2_18_1468_F3 0 18 17330428 255 22M CAACACTTTGCTCCAACATTGA IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:18A0A0C1 NM:i:3 CM:i:2
2_18_1468_F3 16 21 55207881 255 22M CTGGCACCAAGATGGGACACCA IqqqqqqqqqqqqqqqqqqqqI XA:i:2 MD:Z:0G0A0C0C0G0T0G0G0G0G0A0G0C9 NM:i:13 CM:i:2

Here, the two first alignments are against two chromosomic locations which are identical sequence (perfect match between this two sequence), but if we look the NM field, they are differents ! How a same read which map against two identical sequences can be have a mismatch number different ? So, I wonder if bowtie can manage colorspace (and SNP) and how ?

Thanks
rlegendre is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:48 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO