Tweet
- With the version 2 of tophat I get an '*' as quality sequences in the bam file for more that 70% of the reads.
Ex:
Read 1
GCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAACTCCGCCG DDDDDDDFFFGHHHJJIJIJIIIJJIGGHIGJJJJJJHGHHHFFFFFCC@
Read 2
GGCGTGTGTTGC *
Read 3
CCGGCCCTCGCTCCAGCAGCTGGACCCCTACCTGCCGTCTGCTGC *
Read 4
CAACTGCTGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTC C@CFFFFFHGHHHIGHJJIIJICEHIGIIIIGHJGIJJJBGDFGGHHIIIH
The bam file for this same sample with tophat 1.4 is ok.
Has someone encountered this problem? THank you
-
-
Why are your read lengths different. Looks like the two that are the same size have proper quality strings -
I encountered the same problem.
Problem was alleviated by switching back to 1.4.1.Comment
-
My reads were filtered for quality. But the same problems happens without filtering. And version 1.4 corrects the problem as mentionned by pzumbo.Comment
-
I'm having the same issue with tophat2. I just posted over here: http://seqanswers.com/forums/showpos...66&postcount=4Comment
-
I had the same problem when running tophat2 with bowtie2. However, I did not see this issue after running tophat2 with the --bowtie1 option. Thus, it might be problem with bowtie2.Comment
-
The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist on Modified Bases...Yesterday, 07:01 AM -
Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...04-04-2024, 04:25 PM
Comment