Hey guys,
I'm looking to demultiplex a single sff into ~480 samples using a fairly complex primer design. We have 3 pools of samples that have plate and template specific sequences (6 template-specific sequences - F+R x 3pools), as well as a 13 454 MIDs at either side of the forward and reverse. Looks very similar to this:
Forward primer (Primer A-Key):
5’ - CGTATCGCCTCCCTCGCGCCATCAG - {MID} - {template-specific-sequence} - 3‘
Reverse primer (Primer B-Key):
5’ - CTATGCGCCTTGCCAGCCCGCTCAG - {MID} - {template-specific-sequence} - 3’
Now, we've setup the samples so that we have a different F-MID/R-MID combination (using the 13MIDs available), but we are having difficulties assigning the reverses read, compared to the forward read which we can demultiplex nicely. I suspect that we are doing the demultiplexing in the wrong order. We chose to demultiplex according to the MIDs first and then demultiplex based on the template-specific sequence. If I was to demultiplex based on a template specific sequence first, would I trim off the MID identifer and making me unable to demultiplex based on MIDs?
Has anyone had any experience and advice on how to demultiplex with this project design?
I'm looking to demultiplex a single sff into ~480 samples using a fairly complex primer design. We have 3 pools of samples that have plate and template specific sequences (6 template-specific sequences - F+R x 3pools), as well as a 13 454 MIDs at either side of the forward and reverse. Looks very similar to this:
Forward primer (Primer A-Key):
5’ - CGTATCGCCTCCCTCGCGCCATCAG - {MID} - {template-specific-sequence} - 3‘
Reverse primer (Primer B-Key):
5’ - CTATGCGCCTTGCCAGCCCGCTCAG - {MID} - {template-specific-sequence} - 3’
Now, we've setup the samples so that we have a different F-MID/R-MID combination (using the 13MIDs available), but we are having difficulties assigning the reverses read, compared to the forward read which we can demultiplex nicely. I suspect that we are doing the demultiplexing in the wrong order. We chose to demultiplex according to the MIDs first and then demultiplex based on the template-specific sequence. If I was to demultiplex based on a template specific sequence first, would I trim off the MID identifer and making me unable to demultiplex based on MIDs?
Has anyone had any experience and advice on how to demultiplex with this project design?
Comment