SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
making non-redundant isotig file from newbler output Seqasaurus Bioinformatics 2 09-22-2011 04:44 AM
Cufflinks SAM file sort problem AdamB RNA Sequencing 2 09-14-2010 01:44 AM
MRNM problem for the .sam output file of tophat Gangcai Bioinformatics 4 08-13-2010 09:19 AM
.sam file downloading problem from modENCODE wenrongzeng Bioinformatics 0 04-15-2010 12:38 PM
SAM file flag problem ptong7 Bioinformatics 4 07-30-2009 03:32 AM

Reply
 
Thread Tools
Old 03-12-2010, 10:23 PM   #1
Gangcai
Member
 
Location: Shanghai, China

Join Date: Nov 2009
Posts: 30
Default Redundant(?) report problem in tophat .sam file?

Hi everyone,
I have checked the tophat sam file from tophat1.0.11, and found one reads have been reported twice(same genome location but different optional fields). Why two different mismatch( NM:i:0 , NM:i:1) number for the same reads and same mapping location?


HWI-EAS244_1_1_61_293_716_0_1_6480169;1 19 chr1 1231272 255 47M76N28M = 1231188 0 ACTTCTTTTCCACGTATTTGTCCTTGATCCAGGCCTCCTTGTCCTGCCGGGAGCTGCTGGCTGTGGGTTTCCTGC P\MMY]LR\`a]a``^[FWa`]a[aa\^`a`a^\``X`X```]ZZa\V\aaaaaaa__aa_ababbabbbbaab` NM:i:0 XS:A:- NS:i:0
HWI-EAS244_1_1_61_293_716_0_1_6480169;1 19 chr1 1231272 255 47M76N28M = 1231188 0 ACTTCTTTTCCACGTATTTGTCCTTGATCCAGGCCTCCTTGTCCTGCCGGGAGCTGCTGGCTGTGGGTTTCCTGC P\MMY]LR\`a]a``^[FWa`]a[aa\^`a`a^\``X`X```]ZZa\V\aaaaaaa__aa_ababbabbbbaab` NM:i:1 XS:A:- NS:i:0
Gangcai is offline   Reply With Quote
Old 03-15-2010, 11:26 PM   #2
thinkRNA
Member
 
Location: Carlsbad,CA

Join Date: Jan 2010
Posts: 94
Default

is this mouse or human? Have you tried to blat to see where it should really be landing? this is indeed puzzling and I wonder whether it is a bug in tophat. Even with bowtie's option -a, the same read should not be reported twice at the same mapping location(I think).
thinkRNA is offline   Reply With Quote
Old 03-16-2010, 12:05 AM   #3
Gangcai
Member
 
Location: Shanghai, China

Join Date: Nov 2009
Posts: 30
Default

It's human.
And the blat result is :
ACTIONS QUERY SCORE START END QSIZE IDENTITY CHRO STRAND START END SPAN
---------------------------------------------------------------------------------------------------
browser details HWI-EAS244_1_1_61_293_716_0_1_6480169;1 74 1 75 75 100.0% 1 + 1231272 1231422 151
browser details HWI-EAS244_1_1_61_293_716_0_1_6480169;1 23 50 73 75 100.0% 2 + 220481765 220481795 31
browser details HWI-EAS244_1_1_61_293_716_0_1_6480169;1 20 48 67 75 100.0% 5 + 170003947 170003966 20

So the tophat mapping location is right. The only difference is NM report.
Gangcai is offline   Reply With Quote
Reply

Tags
rna-seq, sam, tophat

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:59 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO