SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
HiSeq1000 readcount differences shubho Illumina/Solexa 2 11-11-2014 12:55 AM
bam-readcount usage ElenaN Bioinformatics 5 08-12-2013 03:59 PM
Samtools view -c Readcount Issue Lalit Bioinformatics 5 06-02-2013 02:06 PM
unalble to clone repository for bam-readcount from github ashwinipatil Bioinformatics 3 03-17-2013 09:10 PM
Samtools....SAM to BAM...warning or error!! Can I ignore? Siva Bioinformatics 12 08-20-2010 06:49 AM

Reply
 
Thread Tools
Old 12-18-2014, 06:37 AM   #1
balthasar
Junior Member
 
Location: Germany

Join Date: Oct 2014
Posts: 5
Default bam-readcount warning

hi everybody,

i am using bam-readcount to filter out false positives from snp calling.

i am getting (sometimes almost 5million) warnings like:
WARNING: In read XXX_XXX_XXX: Couldn't find single-end mapping quality. Check to see if the SM tag is in BAM.

what does it exactly mean?
(please find an example read pair below)

as you can see from the example, both reads have a proper mapq field, so,
1.) where is the problem?
2.) why does it need the sm tag?
3.) why is there no problem with most of the other reads?

thanks so much for any advice! chris

here is one of the read pairs,
XXX_XXX_XXX 99 1 565899 21 50M = 565967 68 CTACGCCTAATCTACTCCACCTCAATCACACTACTCCCCATATCTAACAA `````````````````````````````````````````````````A XA:i:3 MD:Z:2G35T11 XE:Z:-------------------------------------------------- PG:Z:bfast IH:i:1 NH:i:2 HI:i:1 CM:i:0 NM:i:2 CQ:Z:A<A=;>BBB<@>BB@ABBABAAAB?BBABB@BBB?BBA<BBBB@ABBBBA MQ:i:28 AS:i:2100 CS:Z:T22313302303223122011022103211112312200013332230110 RG:Z:4

XXX_XXX_XXX 147 1 565967 28 35M = 565899 -68 GTTTGAACACACAACACCCACCCCATTCCTCCCCA 2HNN""1`\SUX^`M9O````````````\````` XA:i:3 MD:Z:14A20 XE:Z:----11----------------------------- PG:Z:bfast IH:i:1 NH:i:2 HI:i:1 CM:i:2 NM:i:1 CQ:Z:@ABBB<7B?;@=BB=:BBA%+9@5:28;B21-8-2 MQ:i:21 AS:i:1300 CS:Z:T01000220203100011001110111111111001 RG:Z:4
balthasar is offline   Reply With Quote
Old 12-19-2014, 12:15 AM   #2
balthasar
Junior Member
 
Location: Germany

Join Date: Oct 2014
Posts: 5
Default

just in case anyone is interested:

https://github.com/genome/bam-readcount/issues/2
balthasar is offline   Reply With Quote
Reply

Tags
bam-readcount, snp, variant calling, varscan

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:34 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO