SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
DNA sequencers 150 bps Output File Arupsss Bioinformatics 5 06-18-2012 04:36 AM
DNA sequencers- required matching errors for 150 bps Arupsss Bioinformatics 0 05-04-2012 07:51 AM
short read length on XL+ vlee2 454 Pyrosequencing 26 04-23-2012 06:43 AM
read length distributions? greigite Illumina/Solexa 1 12-01-2009 07:42 AM
BWA Read Length AnamikaDarwin Bioinformatics 1 04-10-2009 11:47 PM

Reply
 
Thread Tools
Old 06-19-2012, 09:29 AM   #1
Arupsss
Member
 
Location: Trento, Italy

Join Date: May 2011
Posts: 44
Question 150 bps Read Length Issue

I am doing some experiment with BowTie. Now, I want to do experiment with 150 bps read length. So, I download it from here. And converted to fastq format. Now, I see, the fastq format looks like,

Quote:
@ERR103405.1 M10_151:1:2:12250:1321 length=302 ATTTACTGCCTTGTGTCTCCAGTGCGCTGAAAATACCTTTATCTTGAAATAAGTTAACTAACTCTTGGATACCTTTAATTAATGCTGGGTTACCACCAGAAATTGTAACGTGGTTAAATAAATCGCCACCAATACGTTTTAATTCATCATAGAACAGCTGGATGTGATTATCGCTGTAGCTGGTGTGATTCTGCATTTACTTGGGATGGTAGTGCTAAAGGCGATATAAAACTCATGACCGCTGAAGAAATTTATGATGAATTAAAACGTATTGGTGGCGATTTATTTAACCACGTTACAAT
+ERR103405.1 M10_151:1:2:12250:1321 length=302 CCCFFFFFHHHHHHHIHJJJJJIIJJIJJIJJJIIGJJJJIIGIJJHIGIIJJIIIJIIJJIJEIJIJFIIIFJGHHGHHFFFFFFFEDCCACCDA?ABDDDDDDCDC@?<ABBBDDDDEDDDC<?B?@BDDDDDB>CC@C:>AADDCACDB@CFFFDDHHBFHEHIIIIIGJIHHEGHIIHE1C?D?GGGIIIIGIFI>BHHIJ@3CHBDGGICHGEHIIGHE>BEDEDE;ACCDDCCA?B=BBCDCCCC@@>>C@CDC>@DCDCDDD<<@?AC(2??BDBDBCDCDDCC::?881<?C>:
Now in NCBI, they described it as "DNA for paried end (150bp) sequencing on an illumina MiSeq". But here it looks it is 302 bps read. Can anybody help me why it is given in above sequence, "length=302" while it is written in the page that it is a 150 bps read.
Arupsss is offline   Reply With Quote
Old 06-19-2012, 10:15 AM   #2
NextGenSeq
Senior Member
 
Location: USA

Join Date: Apr 2009
Posts: 482
Default

It's a paired end 151 cycle read
NextGenSeq is offline   Reply With Quote
Old 06-19-2012, 10:24 AM   #3
Arupsss
Member
 
Location: Trento, Italy

Join Date: May 2011
Posts: 44
Default

Quote:
Originally Posted by NextGenSeq View Post
It's a paired end 151 cycle read
Thanks. But, I want to give input 150 bps length read to Bowtie Tool. So, what I should do ? I search for 150 bp and get those as result.
Arupsss is offline   Reply With Quote
Old 06-19-2012, 11:22 AM   #4
HESmith
Senior Member
 
Location: Bethesda MD

Join Date: Oct 2009
Posts: 505
Default

For technical reasons, the error rates are higher for the last base. Those can be removed with a variety of tools (e.g., Trimmomatic). I suggest you search the wiki.
HESmith is offline   Reply With Quote
Old 06-19-2012, 11:26 AM   #5
Arupsss
Member
 
Location: Trento, Italy

Join Date: May 2011
Posts: 44
Question

Quote:
Originally Posted by HESmith View Post
For technical reasons, the error rates are higher for the last base. Those can be removed with a variety of tools (e.g., Trimmomatic). I suggest you search the wiki.
Thanks. But, it is not possible to get 150 bps read length .sar file and fed it into Bowtie ? Another point is: here (http://www.ncbi.nlm.nih.gov/sra/SRX145461) it says 1 forward, 151 reverse. Can you inform does it mean ?
Arupsss is offline   Reply With Quote
Old 06-19-2012, 11:33 AM   #6
HESmith
Senior Member
 
Location: Bethesda MD

Join Date: Oct 2009
Posts: 505
Default

Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base). Paired-end sequencing doubles the number of cycles: 2x151=302. SRA contains the raw (i.e., untrimmed) data.
HESmith is offline   Reply With Quote
Old 06-19-2012, 11:44 AM   #7
Arupsss
Member
 
Location: Trento, Italy

Join Date: May 2011
Posts: 44
Default

Quote:
Originally Posted by HESmith View Post
Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base). Paired-end sequencing doubles the number of cycles: 2x151=302. SRA contains the raw (i.e., untrimmed) data.
Is paired end read (or 1 forward, 151 reverse) means first end is taken from DNA's forward stand and second one taken from DNA's reverse strand ? Means are they reverse complement ? Sorry, I have very little idea about Bioinformatics. Another point is,

"Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base)" - is this means last base of 151 bps should be dropped by the tool ?
Arupsss is offline   Reply With Quote
Old 06-19-2012, 11:46 AM   #8
HESmith
Senior Member
 
Location: Bethesda MD

Join Date: Oct 2009
Posts: 505
Default

The answers to your questions can be found by searching the forum.
HESmith is offline   Reply With Quote
Reply

Tags
bowtie, fastq reads, illumina fastq, read alignment

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:39 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO