SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
TruSight Tumor 15 adapters linda_kohn Illumina/Solexa 0 09-13-2016 06:06 AM
Ligation of Illumina adapters to custom adapters ale Sample Prep / Library Generation 2 02-29-2016 12:42 AM
Trusight tumor troubleshooting ahpolani Sample Prep / Library Generation 0 08-14-2014 02:52 AM
TruSight/VariantStudio almstrup Illumina/Solexa 0 03-10-2014 02:34 PM

Reply
 
Thread Tools
Old 03-01-2018, 06:37 PM   #1
jamessmith260996
Junior Member
 
Location: vietnam

Join Date: Mar 2018
Posts: 1
Default TruSight Tumor 15 adapters

Hi,

Does anyone know the adapter seq used in TruSight Tumor 15?

I get hits for CTAGCCCTCAATCCCTGACCCTGCAAGGTGGAATTCTCGGGTGCCAAGGA in R1 and
CCTTGCAGGGTCAGGGATTGAGGGCTAGAGATCGGAAGAGCGTCGTGTAG in R2 but I guess there is more to it...
jamessmith260996 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:07 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO