
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
Paired-end Bam from single-end aligned sam ramouz87 Bioinformatics 4 08-17-2011 01:55 PM
How to infer Illumina paired-end strand specificity from SAM output? David Harmin Bioinformatics 0 02-16-2011 09:34 AM
BWA alignment for paired end reads AvinashP Genomic Resequencing 2 06-08-2010 04:11 AM
TopHat SAM - Expressing Paired End Multi-reads Bio.X2Y Bioinformatics 2 05-28-2010 09:07 AM
losing %reads aligned with Bowtie paired end analysis Batool Bioinformatics 0 04-21-2010 10:14 AM

Thread Tools
Old 03-09-2011, 05:00 AM   #1
Junior Member
Location: Dublin

Join Date: Mar 2009
Posts: 6
Default bwa bug? Paired end reads with insert size of 0 flagged as improperly paired

I'm looking at some paired end WGS data from a library with very small insert sizes, meaning that many of the DNA fragments are sequenced fully in both directions.

Reads were aligned to a template genome using BWA. For many reads, the insert size is zero (i.e. forward and reverse strand coordinates are identical) These reads are being flagged by bwa sampe as improperly paired (sam flags 81 & 161 or 97 & 145), whereas I think they should count as properly paired.

My question is whether downstream tools (specifically GATK realignment and SNP calling) will exclude these reads, and if so what I would need to do to get round the problem. (One workaround solution would be to extract these improperly paired reads, trim an extra base from the 3' end, then realign.)

As an example:
HWUSI-EAS174:5:102:602:453#0 97 chr1 66904 15 22M = 66904 22 CCAGGAGGCAGCAGCAGTAGCC B@?AA=A@@=A><>=A94>==9
HWUSI-EAS174:5:102:602:453#0 145 chr1 66904 15 22M = 66904 -22 CCAGGAGGCAGCAGCAGTAGCC B=6B4@A?69@9<B?;7=BABA



Last edited by spark; 03-09-2011 at 01:55 PM. Reason: Changing title to something clearer
spark is offline   Reply With Quote

bwa, paired end, sam flag

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 06:32 PM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2022, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO