We are trying to do single-cell TCR sequencing using Mark Davis protocol based on his 2015 Nature Biotech publication. The link for the paper is:
We used the same primer set as the paper. The PE primers for the final PCR reaction are:
PEprimer1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PEprimer2: AAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
My questions are:
1. I can see PEprimer1 contains P5 sequence primer. What is PEprimer2? What should I use for the other end of sequence primer?
2. For the final (third) PCR reaction, do we have to use PAGE purified PEprimer1 and PEprimer2? Do we need to order PE primers modified with phosphorothioate bonds between the two last (3') nucleotides according to Illumina’s Nature Method paper? Or this is just for the sequencing part?
Thank you so much!
We used the same primer set as the paper. The PE primers for the final PCR reaction are:
PEprimer1: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
PEprimer2: AAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT
My questions are:
1. I can see PEprimer1 contains P5 sequence primer. What is PEprimer2? What should I use for the other end of sequence primer?
2. For the final (third) PCR reaction, do we have to use PAGE purified PEprimer1 and PEprimer2? Do we need to order PE primers modified with phosphorothioate bonds between the two last (3') nucleotides according to Illumina’s Nature Method paper? Or this is just for the sequencing part?
Thank you so much!
Comment