SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Merging FastQ files from different runs into one? Zapages Bioinformatics 3 09-12-2016 03:48 PM
merging fastq files shilo Illumina/Solexa 8 07-06-2016 02:15 PM
merging two fastq files from exome sequencing rohan_1925 Bioinformatics 4 12-20-2013 08:36 PM
merging two fastq files from exome sequencing Naarkhoo Bioinformatics 8 12-18-2013 11:48 PM
Merging Paired-End FastQ Files jmpi Bioinformatics 3 05-22-2013 08:21 AM

Reply
 
Thread Tools
Old 05-05-2017, 01:32 AM   #1
MP_NGS
Junior Member
 
Location: Norway / the Netherlands

Join Date: May 2017
Posts: 2
Default Merging fastQ files and trimming advice

Hello everyone,

I am new to using NGS techniques and the bioinformatics tools for analysing the acquired data so I hope I can get some advice from more experienced users.

My objective: Assemble the draft genome of my sequenced individual by de novo assembly.

I carried out a single NextSeq500 run of one individual. It was a paired-end sequencing run (150 bp) and I ended up with 8 fastQ files (2 reads X 4 lanes).

Do I take the right approach if I just merge these fastQ files (using the ''cat'' tool)? Do the paired-reads stay ''intact'' so to say, which can be then used by the assembly tool?
After merging I will do a FastQC analysis on this merged file and will use cutadapt to remove adapter contamination and reads with low quality:

Cutadapt command
cutadapt \
- a GATCGGAAGAGCACACGTCTGAACTCCAGTCACATGAGCATCTCGTATGC \
-q 28 \
-m 20 \

Please let me know if you have any tips or advice a different approach.
MP_NGS is offline   Reply With Quote
Old 05-05-2017, 09:41 AM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

You can't simply merge all of the files; you need to merge all the read1's into one file, and and the read2's into a second file, keeping the orders the same. For example:

cat L1_R1.fastq L2_R1.fastq L3_R1.fastq L4_R1.fastq > L1234_R1.fastq
cat L1_R2.fastq L2_R2.fastq L3_R2.fastq L4_R2.fastq > L1234_R2.fastq

Then you can use Cutadapt, though personally I'd suggest BBDuk.
Brian Bushnell is offline   Reply With Quote
Old 05-07-2017, 01:56 AM   #3
MP_NGS
Junior Member
 
Location: Norway / the Netherlands

Join Date: May 2017
Posts: 2
Default

That makes sense, I overlooked that part. Thanks for the reply!
MP_NGS is offline   Reply With Quote
Reply

Tags
cutadapt, fastq, merging, trimming

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:12 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO