HiSeq Library compatible with MiSeq?

[thdybwf]

Hello all -

We've prepared our first library following a protocol originally for the Illumina Genome Analyzer. It's out for QC now and I'm keeping my fingers crossed. I'm now wondering, though, would it be possible to run our single-end library on the MiSeq? Is MiSeq only paired end or does it require a special P2?

The library is prepared using modified Solexa adapters. The second adapter (P2) is a divergence Y-type adapter so only fragments with P1 ligated first will amplify. Here are our adapter sequences:

P1:

[FONT="Courier New"]Top:     5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
Bottom:  3'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-5'[/FONT]

P2:

[FONT="Courier New"]Top:      CTCAGGCATCACTCGATTCCTCCG[COLOR="Silver"]AGAACAA[/COLOR]
Bottom:  ACTCAGGCATCACTCGATTCCTCCGTCGTATGCCGTCTTCTGCTTG[/FONT]

which becomes, after PCR fill-in:

[FONT="Courier New"]Top:      CTCAGGCATCACTCGATTCCTCCGTCGTATGCCGTCTTCTGCTTG
Bottom:  ACTCAGGCATCACTCGATTCCTCCGTCGTATGCCGTCTTCTGCTTG[/FONT]

Will this single-end library work on a MiSeq? If you can explain why or why not, I'd be very grateful. Thank you in advance for any help.

[Yepler]

Take a look at the supplemental info here:

David Bentley in Nature (2008) 456, 53-59 Accurate whole human genome sequencing using reversible terminator chemistry (supplementary material: http://www.nature.com/nature/journal...re07517-s1.pdf)

the adapter sequences described for the the paired-end flow cell work on the MiSeq. The ones used on the single-end flow cell will not work on a MiSeq.

The sad thing is that both of the adapters (single-end, paired-end) will pass the PCR-based QC, because the primers used in the QC amplify both single and paired end. It's only when you try loading the MiSeq that you uncover the problem (yes, I know this from experience!).

Hope that helps!

[NextGenSeb]

Hi!
Illumina published this Support Bulletin earlier this year titled "Considerations for Library Migration from HiSeq/GA to MiSeq"
In Summary:

1. MiSeq flow cells are paired end, single end libraries require new library prep
2. MiSeq annealing and deblocking temperatures are higher than on the HiSeq, which means the sequncing primer hybridization temperature must be >=65 degreeC
3. The MiSeq is about 50% more efficient in cluster generation than the HiSeq, which has to be taken into consideration when choosing the library concentration to load

In general you should be fine as long as you have PE libraries and are using Illumina sequencing primers. The MiSeq actually has a mode to QC HiSeq libraries, which implies that they should work
Only if you use custom sequencing primers you have to be careful with the temperatures to avoid your primers being stripped off during the chemistry cycles. However in your case with single end libraries the fragments will simply not anneal to the flowcell despite passing PCR QC for the reasons that Yepler pointed out above.

Cheers
Seb