SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Best method to add custom primer to MiSeq Illumina sequencing primers? pmiguel Illumina/Solexa 2 05-24-2019 02:18 PM
MiSeq amplicon sequencing Primers? SDPA_Pet Illumina/Solexa 5 02-20-2019 09:54 PM
Trim MiSeq 16S sequencing primers from raw sequence? Rodney Sun Illumina/Solexa 2 05-20-2014 09:17 AM
Using MiSeq with both standard and custom sequencing/index primers at the same time? kevin_bryant Illumina/Solexa 1 02-27-2014 01:57 PM
Miseq:Trimming, and sequencing primers at the beginning of a read clintp Illumina/Solexa 5 01-15-2014 01:38 PM

Reply
 
Thread Tools
Old 11-26-2019, 10:43 AM   #1
Tom2013
Member
 
Location: Canada

Join Date: Sep 2013
Posts: 16
Default Can I use default sequencing primers for Miseq?

I use below PCR primers to prepare libraries for Miseq amplicon sequencing:

i7-INDEX2-Spacer- gene_specific_Primer

CAAGCAGAAGACGGCATACGAGAT TCGCCTTA GTCTCGTGGGCTCGG +gene_specific_Primer

i5-INDEX2-Spacer+gene_specific_Primer
AATGATACGGCGACCACCGAGATCTACAC-CTCTCTAT-TCGTCGGCAGCGTC+gene_specific_Primer

Compared to Nextera adapters, my primers do not include the tagmentation sequence. I tried to look up Miseq sequencing primers, but still not sure whether my adapters are compatible with Miseq sequencing primers.

Can I use default sequencing primers in Miseq cartridge for sequencing? Does anybody know any website or document to verify that?
Tom2013 is offline   Reply With Quote
Old 11-26-2019, 12:07 PM   #2
ATϟGC
Member
 
Location: Canada

Join Date: Jun 2013
Posts: 51
Default

My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content...0002694-11.pdf
ATϟGC is offline   Reply With Quote
Old 11-26-2019, 12:16 PM   #3
Tom2013
Member
 
Location: Canada

Join Date: Sep 2013
Posts: 16
Default

Quote:
Originally Posted by ATϟGC View Post
My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content...0002694-11.pdf
Thanks a lot for your reply.
Are there any document/post(s) mention that "the sequencing primer binding site is actually contained within the Nextera transposase sequence"?
Tom2013 is offline   Reply With Quote
Old 12-02-2019, 12:47 PM   #4
Tom2013
Member
 
Location: Canada

Join Date: Sep 2013
Posts: 16
Thumbs up

Quote:
Originally Posted by ATϟGC View Post
My guess is that you cannot use the "default" sequencing primers with your scheme.

You appear to have directly attached your gene-specific primer sequence directly to the i5 and i7 illumina indexing primers and therefore lack the sequencing primer binding site, which is actually contained within the Nextera transposase sequence.

Pages 3 and 4 of the following Illumina document might help you:

https://support.illumina.com/content...0002694-11.pdf
You are right!
Tom2013 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:36 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO