Hi All,
I'd like to clarify something which I find odd on my GSNAP output.
I ran GSNAP (version 2015-09-29) like this (i.e. maximally 2 mismatches):
and my output contains hits like this one:
I concluded that maybe due to the trimming the mismatches at the beginning don't count (sub:0), although it clearly stands: align_score:5. Therefore, I switched trimming off using --trim-mismatch-score and --trim-indel-score flags:
An I still get:
sub increased to 5 and align_score stays 5. Why have I got this hit in my results?
What's more, I get:
which got trimmed, even though I turned trimming off.
I guess I'm missing something, please help.
Thanks in advance
Stefan
I'd like to clarify something which I find odd on my GSNAP output.
I ran GSNAP (version 2015-09-29) like this (i.e. maximally 2 mismatches):
Code:
gsnap -d mm9 -s /usr/local/share/mm9/mm9.maps/mm9.iit -m 2 -i 1 -n 1 --quiet-if-excessive poly_coll.fasta > results
Code:
>ATGTCACTCCAATGAAAGCCTTGG 1 100-1 gtgtgcttgCAATGAAAGCCTTGG 10..24 -chr10:125750727..125750713 start:9..end:0,matches:19,sub:0 segs:1,align_score:5,mapq:40,method:sa
Code:
gsnap -d mm9 -s /usr/local/share/mm9/mm9.maps/mm9.iit -m 2 -i 1 -n 1 --quiet-if-excessive --trim-mismatch-score=0 --trim-indel-score=0 poly_coll.fasta > results
Code:
>ATGTCACTCCAATGAAAGCCTTGG 1 100-1 gTGTgctTgCAATGAAAGCCTTGG 1..24 -chr10:125750736..125750713 start:0..end:0,matches:19,sub:5 segs:1,align_score:5,mapq:40,method:sa
What's more, I get:
Code:
>GGAGGAAAAAGTCACAGAAGAAGTGGCTG 1 101-1 aggcagacAAGTCACAGAAGAAGTGGtgG 9..29 -chr2:36642591..36642571 start:8..end:0,matches:19,sub:2 segs:1,align_score:2,mapq:40
I guess I'm missing something, please help.
Thanks in advance
Stefan