Question on BWA output

[rboettcher]

Hi all,

once again I have to ask for your help, since I couldn't find any thread on the board that is reflecting my problem.
First of all: I use artificially created single end reads in Illumina FASTQ format that look like the following (the quality values are not as yet of any concern, that is why it's h):

@Identifier1:1:1:1:1#NNNNNN/1
ACAATGTTTCTCATGCTCCAGTGAT
+Identifier1:1:1:1:1#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhh
@Identifier2:1:2:1:1#NNNNNN/1
TTTCCTCATCTACAACAGTGATTGG
+Identifier2:1:2:1:1#NNNNNN/1
hhhhhhhhhhhhhhhhhhhhhhhhh

To get used to BWA (I used bowtie before and that works fine with the data), I'm aligning them against a small part of the genome (the one I used to create them is included) which consists of several FASTA entries of exons, so basically:

>RefIdentifier1
ACAATGTTTTTGATCTCTTTAACCTCATCTACCTCAGGCAACAATGTTTT
TGATCTCTTTAACCTCATCTACCTCAGGCAGTGCTCATGGTGATTTGTG
CTCATGGTGATTT
>RefIdentifier2
CATCTACCTCAGGCAACCTCATGGTATTTGTGCTCATGGTGATTCCCTA
TCTACTTTTGAACAATGTTTTTGATCTCTTTAACCTTCTCTTTAACCTCCT
CAGGCAGTGGATGATGACTGACTGACTGTTTGATCGTGACTGATCGTG
ATCTTTTTTACGGGACATTAAAAGGCGGGCCCTAAACTGAC

So far I've tried

./bwa aln indexfile readfile.fastq > BWAout.sai

w/ and w/o the -I flag set, and after that:

./bwa samse indexfile BWAout.sai readfile.fastq > BWAout.sam

It produces a SAM file that looks like this (independent of the -I flag):

@SQ SN:RefIdentifier1 LN:124
@SQ SN:RefIdentifier2 LN:133
@SQ SN:RefIdentifier3 LN:189
@SQ SN:RefIdentifier4 LN:140
@SQ SN:RefIdentifier5 LN:120

I tried to get some information out of this but couldn't find anything comparable on the web or the manuals so far. So to make it short: I have no clue what to do with that file and why it looks like it does, since the once described elsewhere look completely different, as far as I can tell.

Any help is much appreciated, thanks in advance.

Regards

[gaffa]

That's the SAM header that you're seeing there, with the record type SQ being the sequence dictionary (SN = sequence name, LN = sequence length) of your reference. The read alignments should be below the header in the file (are they? - if not there's a problem).

For more info on the SAM format see the publication http://www.ncbi.nlm.nih.gov/pubmed/19505943 and the format specification http://samtools.sourceforge.net/SAM1.pdf.

[rboettcher]

Ok in this case there is a problem, as there are just headers in the file. Unfortunately, I don't get any error messages during the alignment, so I have no idea where to start looking for mistakes. Anyway, thank you for your quick reply.

[rboettcher]

Solved, I reinstalled BWA and retried the alignment after indexing the whole reference again and it worked, no idea what went wrong in the first place...

Thanks anyways.