[BearClaw]

I have pooled libraries before and after SureSelect targeted enrichment. The barcodes have come out fairly even (within the limitations of the very low amounts of starting material). I am now turning to having my adaptors still have the barcodes as the first six bases of the reads, but with the 'Y' adaptors used by more up-to-date illumina protocols. This has required a redesign of the adaptors. A single example with the barcode AACCTT is below:


+adaptor 1 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCTAACCT*T 3'
-adaptor 1 5' [Phos]-AGGTTAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG 3'

In this case, both read 1 and read 2 will have the barcode sequence, so you need to either balance your barcodes so that the 'A', 'C', 'G' and 'T' are fairly even in the first four cycles (like in my original post with four barcodes). Alternatively, you need to change the protocol of the RTA program to use different cycles (like cycles 7-10) to set phasing and intensity values. The Illumina sales rep can show you how to do this.

[polyhedron]

Now (sorry for that long time due to many delays) I can report my result for first pooling then capturing: it works, although not perfect.

I used 4-letter barcode, like:
5'-adaptor-TAACCT
3'-adaptor-ATTGGp

The priliminary results are not so good as capturing without pooling, e.g. shorter read length (got less than <80 but run for 100bp) and worse mappability. And evenness is not so good (we mixed each sample equally using nanodrop rather than the recommended 2100, since we are poor), the highest coverage is about 4 time the lowest, and 23% of reads could not be assigned to any sample according to the barcode (some N got sequenced). So it's fine with SNP discovery, but if coverage is strictly needed or some quantification, I would suggest to improve ro to go other ways.

[greigite]

truncated adapters in library clones

Hi,
Thought I'd resurrect this old thread as we are seeing a similar phenomenon in our libraries to the OP. Specifically, we cloned and Sanger sequenced some standard genomic PE libraries and are seeing truncation of the adapters from the 5' end in some libraries, as well as a larger number of molecules containing full PE1 sequences than full PE2 sequences. We used NEB library preparation kits and some custom barcoded adapters from Invitrogen, which contained the phosphothiorate modification and were purified using desalting. Following triplicate 4 cycle PCR, we cloned several of the libraries into the Fermentas blunt end pJet vector and Sanger sequenced several transformants. While some clones looked normal, several had truncations off the 5' end of PE1 (see attachments). These truncated sequences did contain some bases from the PCR primer on both sides, meaning that we weren't just sequencing unamplified ligated molecules, and there were no adapter-only clones. I haven't been able to come up with a reason why the primers themselves should be truncated aside from being poorly synthesized- but that surprises me since I have not had similar problems with Invitrogen oligos in the past. We are not sure what steps to take next- should we just qPCR quantify the libraries with Kapa so we know how many correct molecules are present and use that to estimate loading amounts? Or did we go wrong elsewhere in library prep?

[athos]

The SureSelect kit comes with three blocking reagents. I added 0.6 uL of a fourth blocking reagent. The fourth blocking reagent was made by mixing equal volumes of each 100 uM index primer (+ and - strands). I didn't try this protocol without the added index primer in the block, so am only assuming that it is needed.

Hi BearClaw,
I was wondering what size your target region was, and also what percentage of your sequence reads were 'on target'? Sorry if the info is here and I've missed it!
Cheers

[gsavych]

The sureselect protocol includes blocking oligos during hybridization. For a paired-end library prep, novel sequence is introduced to the ends of genomic fragments by ligation and asymmetric pcr. The blocking oligos are used during hybridization to prevent duplex formation between the adapter regions of the genomic fragments. If the prepped library was not blocked, targeted fragments would also capture nonspecific fragments annealed to the adapters, making the targeted region a lesser proportion of the capture. As a result, a greater amount of sequencing capacity would be needed to achieve the desired depth of coverage.

That said, the paired-end and the multiplex oligos are very similar. It is possible that you used the paired-end blocking oligos on the multiplex prepped libraries. I am interested in the method you used, please describe the pooling before hybridization and the post-hybrid amp. When considering this approach we were concerned about bias. We have seen good results with scaled-down (1/5 volume) hybridizations.

to upenn_ngs
we are trying out illumina's truseq kit for multiplexing and would also like to use the blockers during the hybridization step. we have all the oligos corresponding to their adapters as well as their reverse compliments that i was gonna add to the hybridization reaction. how much of the blokers would you recommend using?

[upenn_ngs]

to upenn_ngs
we are trying out illumina's truseq kit for multiplexing and would also like to use the blockers during the hybridization step. we have all the oligos corresponding to their adapters as well as their reverse compliments that i was gonna add to the hybridization reaction. how much of the blokers would you recommend using?

Short answer: Final [ ] for each oligo 50uM

The truseq multiplexed libraries include the index before the enrichment. To maintain the integrity of these barcodes, we use a short-oligo strategy to block the clustering and the sequencing elements. See attached.

[gsavych]

Short answer: Final [ ] for each oligo 50uM

The truseq multiplexed libraries include the index before the enrichment. To maintain the integrity of these barcodes, we use a short-oligo strategy to block the clustering and the sequencing elements. See attached.

thanks a lot, this is great! just a quick question - what is the purpose of the ddC at the 3' of P7_b2_f?

[upenn_ngs]

thanks a lot, this is great! just a quick question - what is the purpose of the ddC at the 3' of P7_b2_f?

To prevent the oligo from serving as a primer for extension during post-hybridization PCR.

[abcd41]

Did anybody try to pull 12 libraries with different indexes together before capture with SureSelect? And then sequenced captured fragments in single lane on HiSeq?
Any recommendations?
What is the maximum number of libraries can be pooled (before capture) with good results?
Any limitation on target size design when plan to capture 12 pooled libraries?

Thank you.

[Fiona]

Would you provide me the information regarding the contents of each blocking buffer #1, #2, and #3 in the AgilentSureSelect Target Enrichment for Illumina Paired-End Multiplexed Sequencing. And also is there anyone who tried the Nextera DNA samp prep kit + Nimblgen capturing (EZ exome SR ver 2.2) or the Nextera DNA samp prep kit + AgilentSureSelect Target Enrichment for Illumina Paired-End system? How did you prepare the blocking oligos? Thank you!

[NextGenSeq]

You can only pool 2 to 3 whole exome captures on a single lane of the HiSeq if you want sufficient coverage for SNP and indel detection.

[Fiona]

Thank you for your comment. We will not pool for whole exome sequencing but will pool the samples for targeted sequencing. I just would like to know how we can design the blocking oligos for hybridization of Nextera library (both with barcoded and without barcode) for Illumina Paired-End Sequencing. I would appreciate your information.

[Fiona]

The TruSeq library prep kit seems to be compatible with Agilent SureSelect. Do we still need to change or add the blocking oligos for hybridization? Please let me know. Thank you!

[ibuyufo]

Has anyone managed to make a homebrew that mimic the sureselect kit?