SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
GATK base quality recalibration suppose to keep old and new quality scores? Heisman Bioinformatics 2 10-21-2011 08:40 AM
Soap Splice aligner newbietonextgen Bioinformatics 0 04-28-2011 01:47 PM
SOAP denovo output to AFG format Autotroph Bioinformatics 0 02-21-2011 02:00 PM
SOAP output format - description? Aengus Bioinformatics 2 09-08-2010 07:26 AM
BOAT aligner output format converter? rahul.m.dhodapkar Bioinformatics 0 06-30-2010 07:28 AM

Reply
 
Thread Tools
Old 08-18-2009, 04:48 PM   #1
RLamb
Junior Member
 
Location: NH

Join Date: Aug 2009
Posts: 1
Default SOAP aligner output format? and composite quality scores?

Hi,

could someone please tell me what the output of SOAP aligner looks like (e.g. one sample line, with explanation of what the various items are). The thing is, I want to feed it into SOAPsnp, but I can't use the aligner cause its executables run only on a Unix platform which I don't have (easy) access to (the snp program comes as source code, but I'm not proficient enough in C to sort through it and see what input it takes). I've tried extracting the alignments from my bowtie .map file and reshuffling them in various ways like <position> \t <sequence> \t <quality string> \n, but soapsnp always gives a "Bus error".

On a related matter, does anybody know of a simple, intuitive metric for the quality of a consensus sequence? For example, if a given position (in haploid DNA from a single source, so the real sequence is a single allele) is covered by 5 reads, and it reads A in 3 of them with Phred scores of 15, 25 and 30, and G in the other two with qualities 20 and 30 - what is the probability that the actual sequence is A? What that it's G?

Thanks!
RLamb is offline   Reply With Quote
Old 09-07-2010, 07:15 PM   #2
jayce_ocean
Junior Member
 
Location: location

Join Date: Sep 2010
Posts: 5
Default SOAPAligner output format

hi

i am interested to know the SOAPAligner output format..can anyone share it?thanks..
jayce_ocean is offline   Reply With Quote
Old 08-30-2011, 09:04 AM   #3
ormium
Junior Member
 
Location: basel , switzerland

Join Date: Aug 2011
Posts: 3
Default

http://soap.genomics.org.cn/soap1/#Formatofoutput



Romeo Kienzler
r o m e o ( a - t ) o r m i u m . d e
ormium is offline   Reply With Quote
Old 09-09-2011, 06:20 AM   #4
ormium
Junior Member
 
Location: basel , switzerland

Join Date: Aug 2011
Posts: 3
Default

And here is an example (made by hand, so not sure if it is correct):

10 AAAGTCAATTATCAAGTTGAACCAGCTCGTGTTGGT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 86299 0
15 AGCTAGTCCCGAAGAAAATCTAGGTGGAATCGGGGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 142141 1 C->35G30
13 TGGTTTTGGTGGTATCGGTGGAGAGTATATCAAGCC IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 241778 0
2 CAAGAAATCGGTGTGGCAGAAGCCTTTACAGCGGTT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 297899 0
12 AAAATTGCATAAAATAGGTAGCTAGCTCTGCTAGCT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 397758 0
8 AGCTTTAATATCTATATTAGTGGTATTGATGCTTAT IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 553513 0
14 GGAAGAAGAAGGAAATCAAGAAGGGAATAATATAGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 626711 0
1 GCCTGTTCTTTACATGATTTTTGGTCTAGTGTATGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 766133 1 A->31T30
11 GATTACTTGTAATTATACGTTACAAAATCATATTGG IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 1503808 2 A->30T30 A->32T30
9 AGACTTAACCCAACAACTTTTTGAATTAAGCGAGGA IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 37 a 37 + Streptococcus_suis 1779842 0
ormium is offline   Reply With Quote
Reply

Tags
composite quality, consensus sequence, file formats, snp discovery, soap

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:44 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO