SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
soapaligner error [email protected] Bioinformatics 1 02-20-2013 02:43 PM
Query bam file and assemble reads dustar1986 Bioinformatics 10 09-29-2011 07:48 PM
Unable to create index file in soapaligner [email protected] Bioinformatics 1 06-16-2011 04:01 AM
Query :: Unable to create index file in soapaligner sujata Bioinformatics 0 02-06-2011 08:25 PM
query on file format conversion Alaguraj SOLiD 3 09-24-2010 03:58 AM

Reply
 
Thread Tools
Old 04-24-2010, 09:38 PM   #1
peromhc
Senior Member
 
Location: Durham, NH

Join Date: Sep 2009
Posts: 108
Default SOAPaligner problem: Query File Error: Can't read

So what seems to be a super-easy problem has proved itself difficult to resolve. I've posted the the SOAP mailing list and to the contact email listed on the SOAP website...

Basically, I get this an error that seems to refer to the input fasta file..

The command:
Code:
[email protected]:~/soap-2.20$ ./soap -D /home/macmanes/soap-2.20/ 
tuco.fa.index ľa /home/macmanes/soap-2.20/reads_a.fa -o /media/hd/tuco/mrna/ 
SOAP_results/soap

The painful results:
Code:
Begin Program SOAPaligner/soap2 
Fri Apr 16 12:51:34 2010 
Reference: /home/macmanes/soap-2.20/tuco.fa.index 
Query File Error: Can't read
Here are the reads:
Code:
[email protected]:~/soap-2.20$ head /home/macmanes/soap-2.20/reads_a.fa 

>1 
CAGATATCTTGGGGAGCTCCGGGCGTAGCAGGGTTGGGGAGCCGTGAGAGGGGGCGGCTGTCAGGGCCGGGTGGCACCGGGCGGGCGCGCGCCCGCCTGCCT 

>2 
CGGGAAGCGGGGAGCCTGAAGCTGGGGCCACCCCTCGCCGCCACCGGCGTGCAGCCGCCCAGGATTGCAGCCCGGAAGGGTCCCCCTGCAGGGGGTCTGGCG 

>3 
GTTCCATGTGAACAGCAGTTGAACATGGGTCAGTCGGTCCTGAGAGATGGGCGAGCGCCGTTCCGACGGGACGGGACGACGGCCTCCGTCGCCCTCAGCCGC 

>4 
TGGGTCCCCATTAGAGGCGGTGAAATCGATGGCCACCGTGAAGCTGGTCTGGCAGCCGCCCCTGATGTAACCCAGAGACGGTGTGCACCTTTTCCACCGCGC 

>5 
GCCAGCCTGAACAACATCATGAGACTTTGTCTTGGGAGGCAAAAAGAGAAACTTAGACTATTCACATTAGAAATCAAGTAACAGAAACAACATCTCCATTCA
The error seems so elementary, yet, I have been unable to solve. The reads seems to be fine, and permissions are set appropriately.

Anybody know how to fix this problem?
peromhc is offline   Reply With Quote
Old 04-24-2010, 11:10 PM   #2
Pepe
Member
 
Location: Germany

Join Date: Mar 2009
Posts: 28
Default

I haven't used SOAP, but I found once a software that did not like numbers as fasta headers.
Pepe is offline   Reply With Quote
Old 04-25-2010, 12:34 AM   #3
peromhc
Senior Member
 
Location: Durham, NH

Join Date: Sep 2009
Posts: 108
Default

yeah, I dont think that's it: I've tried a few different input files, and none of them work.. All these are 101bp Illumina reads.. I wonder if SOAP can handle reads this long.
peromhc is offline   Reply With Quote
Old 04-25-2010, 12:42 AM   #4
baby1885
Member
 
Location: china

Join Date: Jan 2010
Posts: 13
Default

SOAP2.20 can support fasta format
baby1885 is offline   Reply With Quote
Old 04-26-2010, 07:46 AM   #5
peromhc
Senior Member
 
Location: Durham, NH

Join Date: Sep 2009
Posts: 108
Default

Quote:
Originally Posted by baby1885 View Post
SOAP2.20 can support fasta format
yeah, just not MY fasta I guess..
peromhc is offline   Reply With Quote
Old 09-07-2010, 06:56 AM   #6
Mansequencer
Member
 
Location: Canada

Join Date: Jul 2010
Posts: 16
Default

Hi Peromhc,
Did you find a solution to your problem of SOAP2 not reading the file. In my case it seems to read the forward file just fine but when I try to do PE alignment, SOAP come with error Cannot write output file.
Any ideas,
Thanks.
Mansequencer is offline   Reply With Quote
Old 09-09-2010, 03:26 AM   #7
trummas
Junior Member
 
Location: Germany

Join Date: Nov 2008
Posts: 2
Default

Hi Everybody,
I ran into the same problem.
The solution was simple though, after some help from a friend :-). Make sure that the dashes for the command line are the right ones. They might not be if you copy the example on how to run it from the SOAP webpage. So just make sure that the "-" in front of a, D and o is the right one. If you look carefully on the example on the SOAP webpage the dash in front of the "a" is a "long dash". I just exchanged it and now it runs as it should.

Hope this helps.
Cheers,
Tomas
trummas is offline   Reply With Quote
Old 04-26-2011, 02:04 AM   #8
jorgill
Junior Member
 
Location: Edinburgh

Join Date: Feb 2011
Posts: 1
Default

I've been having the same problem, changed the short dash to long dash (guess all dashes are not born equal).
This changed my error message to a simple:
"Reference:
Query File Error: Can't read"
jorgill is offline   Reply With Quote
Reply

Tags
illumina, soap

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:11 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO