SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Novoalign Output Missing jlelias Bioinformatics 4 11-07-2012 12:55 PM
using vcf tools to extract genotype information rna_seeker Bioinformatics 3 07-10-2011 05:25 PM
[Help!] How can I extract high quality reads from the output file of NovoAlign qc.share Illumina/Solexa 0 09-27-2010 09:41 AM
sam output from novoalign bioinfosm Bioinformatics 1 01-06-2010 01:04 PM
Novoalign with direct SAM output sparks Bioinformatics 1 07-03-2009 07:27 PM

Reply
 
Thread Tools
Old 09-20-2010, 12:22 PM   #1
qc.share
Junior Member
 
Location: kansas CIty

Join Date: Sep 2010
Posts: 3
Default Help:how to extrcate information from the output file of Novoalign mapping tools

Hello, Everyone,
I want to extrcate some information from the output file of NonoAlign mapping tool, the output file format is FASTQ format, it likes this:
@HWUSI-EAS1522 100625:1:1:1290:9446 # 0/1
CGTCTCGTCTCGTCTCGTCTCGTCTCGTCTCGTCTA
################################ QC

I have 2 questions:
*The first question is what's the detail meaning of number in the first line (HWUSI-EAS1522 100625:1:1:1290:9446 # 0/1)?

* The other question is how can I get the tab-separated files without headers containing four coulumns( 1 chr of reads; 2 the start position of the mapped read; 3 the stop position of the mapped read; 4 the strand information) which were extrcated from the output files of NovoAlign mapping tools.

Thank you very much!

qc.share
qc.share is offline   Reply With Quote
Old 09-20-2010, 02:28 PM   #2
svl
Member
 
Location: Netherlands

Join Date: Sep 2009
Posts: 43
Default

Quote:
Originally Posted by qc.share View Post
the output file format is FASTQ format
Are you sure this is not the input format? I've never used Novoalign, but when mapping you normally use fastq as input and SAM/BAM as output (as is stated on the novoalign website as well...) A SAM/BAM holds mapping information such as your requested parameters, the fastq obviously doesn't.

Quote:
what's the detail meaning of number in the first line
This is information about the the generated read such as machine, run, flowcell, lane, tile and paired-end/single-end.

Quote:
how can I get the tab-separated files without headers containing four coulumns
SAM output will contain such information.
svl is offline   Reply With Quote
Old 09-20-2010, 06:31 PM   #3
qc.share
Junior Member
 
Location: kansas CIty

Join Date: Sep 2010
Posts: 3
Default

Thank you very much!

Quote:
Originally Posted by svl View Post
Are you sure this is not the input format? I've never used Novoalign, but when mapping you normally use fastq as input and SAM/BAM as output (as is stated on the novoalign website as well...) A SAM/BAM holds mapping information such as your requested parameters, the fastq obviously doesn't.


This is information about the the generated read such as machine, run, flowcell, lane, tile and paired-end/single-end.


SAM output will contain such information.
qc.share is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:43 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO