SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to extract mapped and unmapped raw reads from bwa's sam file ? vaibhavvsk Bioinformatics 11 02-07-2013 10:01 AM
Extract paired end reads from sff file. ojy Bioinformatics 4 12-13-2012 05:07 AM
Extract perfectly mapped reads from SAM/BAM file Graham Etherington Bioinformatics 2 07-21-2011 08:27 AM
Help:how to extrcate information from the output file of Novoalign mapping tools qc.share Illumina/Solexa 2 09-20-2010 07:31 PM
filter high quality solexa reads strob Bioinformatics 1 12-08-2009 06:19 AM

Reply
 
Thread Tools
Old 09-27-2010, 10:41 AM   #1
qc.share
Junior Member
 
Location: kansas CIty

Join Date: Sep 2010
Posts: 3
Default [Help!] How can I extract high quality reads from the output file of NovoAlign

Hello Everyone,
Now, we are trying to extract uniquely aligned reads(or high quality reads) from the output file of Novoalign.
There are 5 different reads in this file(please see below), which kind of reads could be used to export the methylation signals(MeDIP-seq)?
In our Service Report, there are 2 kind of reads:
1) Aligned reads:The reads aligned to reference genome with no more than 2 mismatches.
2) Uniquely aligned reads: The reads aligned to the unique location in the genome.
I found that "Uniquely Aligned Reads" have more than 2 mismatches (for example:34G>C 35T>C 36G>T).

@HWUSI-EAS1522_100625:1:120:18868:18135#0/1 S AAGAGGTTTCCAACGAAGGCCTCAAACAGGTCAATG #################################### QC
@HWUSI-EAS1522_100625:1:2:3391:8944#0/1 S AAAGTAAAGTGTGATGAGGCATCGTGAACTGAAACC "0''')',((,33338AAAAAAAAAAAAAAAAAAAA8" U 37 54 >chr22 27508807 F . . . 1G>A 2C>A
@HWUSI-EAS1522_100625:1:120:18870:10840#0/1 S CCATTCCATTCCATTCCACTCCACACCACTCCACTG CCCAACBCCCCCCCCCCCC<CCCCACCCCCCCCCCA R 6
@HWUSI-EAS1522_100625:1:2:3509:1310#0/1 S AGTGAGGACCTGGATCGGCACAGCGCACTGCAGCGC )&)))00000AAAAAAAAAAAAAAAAAAAAAAAAAA U 6 96 >chr22 20772761 R . . .
@HWUSI-EAS1522_100625:1:2:3662:5720#0/1 S AGGACAAGCTGAGATGAATAGTGTTTTGCAAAGGAG "-'&'(3,,//AAAAAAAAAAAAAAAAAAAAAAAAAA" U 40 62 >chr22 33074711 R . . . 34G>C 35T>C 36G>T

So, If I want to choose high quality read to export methylation signal, which kind of read should I use?

Thanks very much, everyone!

qc.share
qc.share is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:28 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO