SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
Length of P5 and P7 adapters from Illumina Gina_P Illumina/Solexa 1 01-12-2012 01:17 PM
How to multiplex Illumina matepair libraries? versa Sample Prep / Library Generation 3 10-24-2011 06:01 AM
bowtie command line for Illumina Hiseq 2000 with Illumina 1.5+ quality encoding files rworthi Illumina/Solexa 4 09-28-2011 12:25 PM
DIY illumina adapters ZAAB Illumina/Solexa 0 05-03-2011 08:00 AM
Multiplex on HiSeq? cbrennan Illumina/Solexa 9 03-24-2011 11:51 AM

Reply
 
Thread Tools
Old 12-07-2010, 06:51 AM   #1
arg
Junior Member
 
Location: Cambridge

Join Date: Oct 2010
Posts: 4
Default Multiplex adapters and indexes for Illumina HiSeq

Dear all,
we are planning on multiplexing our samples in the new HiSeq Illumina we have available. The kits are so extremely expensive that they are not even an option . But many people told us that we can get our own primers/adapters/indexes custom made from IDT. We got custom made adapters for paired end sequencing with the GA and they had a phosphorothioate bond.
Has anybody got these things custom made and know how are all of them purified?
Thanks!!
arg is offline   Reply With Quote
Old 12-07-2010, 08:04 AM   #2
upenn_ngs
Member
 
Location: philadelphia

Join Date: Sep 2009
Posts: 70
Default

The truseq kits from illumina are more reasonably priced than the previous generation (~$50/sample for enzymes and oligos).

We have had success ordering from IDT with HPLC purification. For multiplex, I recommend using a two primer system (illumina index and PCR 2.0 sequence designed as a single primer).
upenn_ngs is offline   Reply With Quote
Old 12-08-2010, 07:45 PM   #3
arg
Junior Member
 
Location: Cambridge

Join Date: Oct 2010
Posts: 4
Default

Hi upenn_ngs,
thanks a lot for your answer. We did not get the TruSeq kit because ordering pretty much everything from IDT was 1/3 of the price...If they decrease the price that much we would start thinking about it....or if the custom made stuff don't work.
And thanks for the tip about pcr primers and indexes, but what exactly you mean with pcr 2.0 designed as a single primer?
Thanks!
arg is offline   Reply With Quote
Old 12-09-2010, 06:14 AM   #4
upenn_ngs
Member
 
Location: philadelphia

Join Date: Sep 2009
Posts: 70
Default

We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.
upenn_ngs is offline   Reply With Quote
Old 02-24-2011, 01:14 PM   #5
alisrpp
Member
 
Location: New York

Join Date: Dec 2010
Posts: 40
Default

Thanks upenn_ngs!
But i have a new question.
We didn't knew the "single primer" recommendation at the moment of ordering the stuff so we ordered the primer 1.0, 2.0 and the indexes separately. Do you think that maybe we can do an annealing of the primer 2.0 and the index? Or in our case is better if we just go ahead with the three primer system?
Thanks!
alisrpp is offline   Reply With Quote
Old 02-24-2011, 01:31 PM   #6
upenn_ngs
Member
 
Location: philadelphia

Join Date: Sep 2009
Posts: 70
Default

Quote:
Originally Posted by alisrpp View Post
Thanks upenn_ngs!
But i have a new question.
We didn't knew the "single primer" recommendation at the moment of ordering the stuff so we ordered the primer 1.0, 2.0 and the indexes separately. Do you think that maybe we can do an annealing of the primer 2.0 and the index? Or in our case is better if we just go ahead with the three primer system?
Thanks!
In my hands, I was unable to reliably produce libraries with the three primer scheme. But move forward and hold your fingers crossed.
upenn_ngs is offline   Reply With Quote
Old 03-09-2011, 10:10 PM   #7
RNAseqer
Member
 
Location: London

Join Date: Sep 2010
Posts: 22
Default

We're now going to get all our adapters and primers from Bioo. The price is now very reasonable and it just doesn't make sense to anneal these ourselves.
RNAseqer is offline   Reply With Quote
Old 06-12-2011, 11:48 AM   #8
parasitehunter
Junior Member
 
Location: NC

Join Date: Jun 2011
Posts: 3
Default

Quote:
Originally Posted by upenn_ngs View Post
We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.
Hi upenn_ngs:
Thanks for your contributions to the forum. We are trying to multiplex using the two primer system you described. Although we have designed the Universal Primer and a number of Index Primers no problem, we're not completely sure what 5' and 3' primer modifications to these are necessary. So far, we've gathered that the Universal Primer requires a 5' phosphate and a 3' phosphorothioate, while the indexing primers don't require any 5' or 3' modifications. Can you or anyone else who's had luck with this system confirm that this info is correct? Thanks in advance!
parasitehunter is offline   Reply With Quote
Old 07-10-2011, 12:38 PM   #9
csmall
Junior Member
 
Location: Texas

Join Date: May 2011
Posts: 2
Default

Hi All,

We are also planning on using the Illumina multiplexing system to sequence restriction fragments on a HiSeq machine. The prior comments seem to indicate that Illumina's 3-primer approach is problematic. If we adopt the suggested 2-primer approach, should I simply combine the PCR Primer 2 and PCR Index Primer sequences, yielding the following oligo design:
5'CAAGCAGAAGACGGCATACGAGATxxxxxxGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3' ?

If anyone is aware of necessary primer modifications beyond this, I'd really appreciate your advice.

Also, is it possible to use additional index sequences, if I would like more than the 12 designed by Illumina?

Thanks very much!
csmall is offline   Reply With Quote
Old 08-11-2011, 06:11 AM   #10
jakeenk
Junior Member
 
Location: canada

Join Date: Aug 2010
Posts: 3
Default

Check out Meyer & Kircher 2010 CSH protocols
jakeenk is offline   Reply With Quote
Old 08-30-2011, 02:43 AM   #11
HGENETIC
still a novice
 
Location: Cardiff

Join Date: Jul 2010
Posts: 34
Default

Quote:
Originally Posted by jakeenk View Post
Check out Meyer & Kircher 2010 CSH protocols
Do you happen to have a pdf of this as I don't have a password to access the full text?

Cheers - H
HGENETIC is offline   Reply With Quote
Old 08-30-2011, 10:19 AM   #12
jakeenk
Junior Member
 
Location: canada

Join Date: Aug 2010
Posts: 3
Default

yup, and http://cshprotocols.cshlp.org/cgi/co...b.prot5448/DC1
Attached Files
File Type: pdf Meyer et al 2010 (CSH Protocols).pdf (231.1 KB, 913 views)
jakeenk is offline   Reply With Quote
Old 08-31-2011, 05:34 AM   #13
HGENETIC
still a novice
 
Location: Cardiff

Join Date: Jul 2010
Posts: 34
Default

Quote:
Originally Posted by jakeenk View Post
Great stuff, thanks jakeenk..
HGENETIC is offline   Reply With Quote
Old 12-07-2011, 01:03 PM   #14
csmall
Junior Member
 
Location: Texas

Join Date: May 2011
Posts: 2
Default

Quote:
Originally Posted by upenn_ngs View Post
We have found that the amplification with a three primer system (multiplex pcr 1.0, multiplex pcr 2.0, and pcr primer index #) does not yield good results. This is the original illumina design. However, multiplex pcr 2.0 and the pcr primer index # oligos have homology and can be ordered as a single, longer primer. This two primer system will yield quality indexed libraries.
Hi upenn_ngs,

We've been testing your suggested two-primer system using Phusion PCR reagents, but I'm afraid without much success. We know our adapter ligation works, we're just struggling with the PCR. Would you be willing to share the details of your working protocol with us? In particular the primer sequences (with any modifications) and PCR specifications (reagents and cycling conditions) would be of great use to us. Thanks for your contributions and advice!

-CS
csmall is offline   Reply With Quote
Old 12-07-2011, 01:55 PM   #15
upenn_ngs
Member
 
Location: philadelphia

Join Date: Sep 2009
Posts: 70
Default

Quote:
Originally Posted by csmall View Post
Hi upenn_ngs,

We've been testing your suggested two-primer system using Phusion PCR reagents, but I'm afraid without much success. We know our adapter ligation works, we're just struggling with the PCR. Would you be willing to share the details of your working protocol with us? In particular the primer sequences (with any modifications) and PCR specifications (reagents and cycling conditions) would be of great use to us. Thanks for your contributions and advice!

-CS
Attached is the most recent working protocol including primer sequence and modifications. This protocol is buried in another thread somewhere in the forum. First half = sample prep; second half = enrichment.
Attached Files
File Type: txt geller_exome.txt (12.7 KB, 529 views)
upenn_ngs is offline   Reply With Quote
Old 05-23-2012, 08:27 PM   #16
Akira
Member
 
Location: Malaysia

Join Date: Sep 2010
Posts: 16
Default

Hi. I have my own customized oligos and I would like to anneal them to make adapters. I've seen many protocols (including the Meyer's one) and I am confused whether to use Annealing Buffer with EDTA or without EDTA.

Now I have the oligos in lyophilized form: in which buffer should I resuspend them? H2O or TE or Tris-HCl?

And for Annealing Buffer:
Tris+ NaCl + EDTA? or TrisHCl only?

I will use NEBNext kit to do the ligation. Will EDTA interfere with the ligation process?

Please help. =(
Akira is offline   Reply With Quote
Old 03-27-2013, 03:20 AM   #17
joze
Junior Member
 
Location: Edinburgh

Join Date: Oct 2012
Posts: 7
Default

Hello everyone,

I realise this thread is pretty old now, but would anyone be able to attach the Meyer paper? I can't access it without subscription.

Cheers,

Jo
joze is offline   Reply With Quote
Old 09-26-2013, 06:42 AM   #18
Aska
Junior Member
 
Location: Oxford

Join Date: Sep 2013
Posts: 1
Default

Hi there,

I was wondering if anyone could let me know what taq polymerase have they used for the multiplex PCR prior to HiSeq Illumina sequencing? Or what are they ways to chose one
Aska is offline   Reply With Quote
Old 10-07-2013, 03:53 AM   #19
joze
Junior Member
 
Location: Edinburgh

Join Date: Oct 2012
Posts: 7
Default

Hello there,

I was advised to use a High-Fidelity polymerase (I used the Phusion High-Fidelity polymerase). Note that the reaction conditions are slightly different using these.

Good luck,

Joze
joze is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:33 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO