SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Extension of reads madhu9124 General 0 06-23-2017 04:46 PM
Change of extension .results MariaGeorge61 General 3 10-23-2014 03:31 PM
Adapter Enrichment PCR barb Illumina/Solexa 25 04-18-2011 02:15 PM
Primer extension capture tiayyba Sample Prep / Library Generation 3 03-28-2010 07:34 AM

Reply
 
Thread Tools
Old 09-12-2018, 12:23 PM   #1
arussell
Junior Member
 
Location: California

Join Date: Sep 2018
Posts: 1
Default Adapter enrichment and extension

Hello,

I am new to RNA-seq, and am working though the details of how the process works. These are the adapters I am working with, that need to be incorporated into the cDNA.

PE1: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3'

Index: 5' CAAGCAGAAGACGGCATACGAGATNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGAT 3' (NNNN represents barcode nucelotides)

To the best of my knowledge, the flow cell sequences are:

p5: 5' AATGATACGGCGACCACC GA 3'
p7: 5' CAAGCAGAAGACGGCATACGAGAT 3'

However, I'm not sure if that means those are the sequences that the adapters need to contain, or if those are the binding site sequences and the cDNA needs to contain the complements. Does this mean that my adapterized cDNA sequences will look like scenario 1, 2, or 3?

1)

5' PE1 --- cDNA --- Index 3'
3' PE1(complement) --- cDNA --- Index (complement) 3'

2)

5' PE1 --- cDNA --- Index (complement) 3'
3' PE1 (complement) --- cDNA --- Index 3'

3)

5' PE1 --- cDNA --- Index 3'
3' Index --- cDNA --- PE1'

**In this case, are the PE1 and Index sequences partially complementary?

Thank you!
arussell is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:03 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO